Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9180Btlr/Mmmh
Stock Number:
069030-MU
Citation ID:
RRID:MMRRC_069030-MU
Other Names:
R9180 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Slc12a8
Name: solute carrier family 12 (potassium/chloride transporters), member 8
Synonyms: E330020C02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 171286
Homologene: 11628
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Ppp1r13b
Name: protein phosphatase 1, regulatory subunit 13B
Synonyms: ASPP1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21981
VEGA: 12
Homologene: 9090
Smarcc1
Name: SWI/SNF related BAF chromatin remodeling complex subunit C1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Ociad1
Name: OCIA domain containing 1
Synonyms: expressed during mesenchymal induction 2, Emi2, B230209J16Rik, 6030432N09Rik, TPA018, Asrij, Imi2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68095
Homologene: 9866
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 36,410,918 bp (GRCm38)
  • A to T, chromosome 1 at 58,339,618 bp (GRCm38)
  • A to G, chromosome 1 at 159,319,769 bp (GRCm38)
  • C to T, chromosome 2 at 25,273,291 bp (GRCm38)
  • T to C, chromosome 2 at 27,292,689 bp (GRCm38)
  • A to G, chromosome 2 at 37,201,280 bp (GRCm38)
  • T to C, chromosome 2 at 76,788,377 bp (GRCm38)
  • T to C, chromosome 2 at 82,985,230 bp (GRCm38)
  • T to G, chromosome 2 at 86,007,981 bp (GRCm38)
  • T to G, chromosome 2 at 112,661,636 bp (GRCm38)
  • C to T, chromosome 2 at 131,179,543 bp (GRCm38)
  • A to G, chromosome 2 at 156,272,617 bp (GRCm38)
  • T to A, chromosome 2 at 158,274,688 bp (GRCm38)
  • A to G, chromosome 3 at 38,888,407 bp (GRCm38)
  • A to G, chromosome 3 at 87,851,763 bp (GRCm38)
  • A to T, chromosome 3 at 116,489,256 bp (GRCm38)
  • G to A, chromosome 3 at 138,183,709 bp (GRCm38)
  • A to C, chromosome 3 at 158,161,374 bp (GRCm38)
  • A to T, chromosome 4 at 90,224,881 bp (GRCm38)
  • T to C, chromosome 4 at 106,359,050 bp (GRCm38)
  • A to T, chromosome 5 at 3,706,276 bp (GRCm38)
  • A to T, chromosome 5 at 30,135,040 bp (GRCm38)
  • G to T, chromosome 5 at 30,588,188 bp (GRCm38)
  • A to G, chromosome 5 at 31,037,846 bp (GRCm38)
  • G to A, chromosome 5 at 34,167,491 bp (GRCm38)
  • A to T, chromosome 5 at 34,561,033 bp (GRCm38)
  • A to C, chromosome 5 at 62,888,067 bp (GRCm38)
  • A to G, chromosome 5 at 73,310,382 bp (GRCm38)
  • A to T, chromosome 5 at 100,884,364 bp (GRCm38)
  • C to A, chromosome 5 at 120,555,935 bp (GRCm38)
  • A to G, chromosome 6 at 41,031,747 bp (GRCm38)
  • T to C, chromosome 6 at 67,766,234 bp (GRCm38)
  • C to T, chromosome 6 at 78,378,460 bp (GRCm38)
  • T to A, chromosome 6 at 120,492,823 bp (GRCm38)
  • G to T, chromosome 7 at 28,103,773 bp (GRCm38)
  • C to A, chromosome 7 at 29,775,448 bp (GRCm38)
  • T to G, chromosome 7 at 85,857,915 bp (GRCm38)
  • T to A, chromosome 7 at 102,753,527 bp (GRCm38)
  • A to G, chromosome 7 at 118,984,319 bp (GRCm38)
  • T to C, chromosome 7 at 126,992,650 bp (GRCm38)
  • T to C, chromosome 7 at 143,764,613 bp (GRCm38)
  • T to A, chromosome 8 at 43,626,933 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • A to C, chromosome 9 at 18,642,742 bp (GRCm38)
  • A to G, chromosome 9 at 105,861,979 bp (GRCm38)
  • T to A, chromosome 9 at 110,135,660 bp (GRCm38)
  • T to A, chromosome 10 at 12,669,719 bp (GRCm38)
  • T to C, chromosome 10 at 68,436,889 bp (GRCm38)
  • T to C, chromosome 10 at 81,535,108 bp (GRCm38)
  • T to C, chromosome 10 at 107,493,457 bp (GRCm38)
  • T to C, chromosome 10 at 129,436,989 bp (GRCm38)
  • G to T, chromosome 11 at 5,989,332 bp (GRCm38)
  • G to A, chromosome 11 at 46,286,093 bp (GRCm38)
  • G to T, chromosome 11 at 58,207,265 bp (GRCm38)
  • A to G, chromosome 11 at 58,625,236 bp (GRCm38)
  • T to A, chromosome 11 at 74,803,000 bp (GRCm38)
  • A to G, chromosome 11 at 93,932,392 bp (GRCm38)
  • A to T, chromosome 11 at 99,809,339 bp (GRCm38)
  • A to G, chromosome 11 at 102,837,264 bp (GRCm38)
  • C to T, chromosome 12 at 7,997,925 bp (GRCm38)
  • A to G, chromosome 12 at 59,204,309 bp (GRCm38)
  • C to A, chromosome 12 at 104,411,181 bp (GRCm38)
  • A to T, chromosome 12 at 111,844,982 bp (GRCm38)
  • C to T, chromosome 14 at 7,818,219 bp (GRCm38)
  • A to G, chromosome 14 at 34,399,201 bp (GRCm38)
  • A to C, chromosome 14 at 41,078,097 bp (GRCm38)
  • C to T, chromosome 14 at 105,153,603 bp (GRCm38)
  • T to C, chromosome 15 at 58,622,381 bp (GRCm38)
  • T to A, chromosome 16 at 17,406,299 bp (GRCm38)
  • T to C, chromosome 16 at 33,541,027 bp (GRCm38)
  • T to C, chromosome 17 at 20,042,825 bp (GRCm38)
  • A to T, chromosome 17 at 22,145,405 bp (GRCm38)
  • A to G, chromosome 17 at 46,668,054 bp (GRCm38)
  • G to A, chromosome 17 at 56,661,252 bp (GRCm38)
  • A to G, chromosome 18 at 57,936,397 bp (GRCm38)
  • T to C, chromosome 19 at 4,153,393 bp (GRCm38)
  • T to C, chromosome 19 at 4,613,325 bp (GRCm38)
  • T to C, chromosome 19 at 29,632,445 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9180 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069030-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.