Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9220Btlr/Mmmh
Stock Number:
069056-MU
Citation ID:
RRID:MMRRC_069056-MU
Other Names:
R9220 (G1)
Major Collection:

Strain Information

Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Sncg
Name: synuclein, gamma
Synonyms: persyn, C79089
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20618
Homologene: 2322
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Tdd5, PROXY1, CMT4D, CAP43, TDD5, DRG1, Ndr1, Ndrl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Bcl2l13
Name: BCL2 like 13
Synonyms: BCL-RAMBO, Mil1, E430016C20Rik, Mil-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94044
Homologene: 9111
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68925
Homologene: 32269
Ddx27
Name: DEAD box helicase 27
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228889
Homologene: 6431
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 66,507,375 bp (GRCm38)
  • A to T, chromosome 2 at 84,723,732 bp (GRCm38)
  • T to C, chromosome 2 at 119,774,188 bp (GRCm38)
  • T to C, chromosome 2 at 167,029,513 bp (GRCm38)
  • T to C, chromosome 3 at 126,943,437 bp (GRCm38)
  • A to G, chromosome 4 at 32,995,924 bp (GRCm38)
  • A to T, chromosome 4 at 53,679,799 bp (GRCm38)
  • T to C, chromosome 4 at 117,877,202 bp (GRCm38)
  • A to G, chromosome 4 at 145,056,488 bp (GRCm38)
  • G to A, chromosome 5 at 31,507,540 bp (GRCm38)
  • A to T, chromosome 5 at 124,794,373 bp (GRCm38)
  • A to T, chromosome 6 at 63,908,904 bp (GRCm38)
  • C to A, chromosome 6 at 120,870,774 bp (GRCm38)
  • A to T, chromosome 7 at 22,437,953 bp (GRCm38)
  • C to A, chromosome 7 at 24,997,200 bp (GRCm38)
  • A to T, chromosome 7 at 26,450,098 bp (GRCm38)
  • C to T, chromosome 7 at 87,321,566 bp (GRCm38)
  • G to T, chromosome 7 at 143,881,165 bp (GRCm38)
  • A to G, chromosome 8 at 3,667,512 bp (GRCm38)
  • T to C, chromosome 9 at 19,121,897 bp (GRCm38)
  • G to A, chromosome 9 at 20,502,041 bp (GRCm38)
  • A to T, chromosome 9 at 38,665,507 bp (GRCm38)
  • T to A, chromosome 9 at 89,602,345 bp (GRCm38)
  • T to C, chromosome 10 at 3,963,805 bp (GRCm38)
  • A to T, chromosome 10 at 89,790,595 bp (GRCm38)
  • C to T, chromosome 11 at 43,598,745 bp (GRCm38)
  • T to A, chromosome 11 at 49,215,248 bp (GRCm38)
  • A to G, chromosome 11 at 71,771,924 bp (GRCm38)
  • GACCTTAGCCAGAAGGAGCCTTAGTTCATCAA to GA, chromosome 11 at 73,223,170 bp (GRCm38)
  • T to A, chromosome 11 at 107,670,047 bp (GRCm38)
  • T to C, chromosome 11 at 117,351,570 bp (GRCm38)
  • T to A, chromosome 12 at 8,986,000 bp (GRCm38)
  • A to T, chromosome 12 at 53,140,449 bp (GRCm38)
  • T to A, chromosome 12 at 76,572,065 bp (GRCm38)
  • T to A, chromosome 12 at 80,721,952 bp (GRCm38)
  • G to A, chromosome 12 at 87,447,606 bp (GRCm38)
  • A to G, chromosome 12 at 98,254,264 bp (GRCm38)
  • A to G, chromosome 12 at 104,713,156 bp (GRCm38)
  • C to A, chromosome 12 at 108,514,443 bp (GRCm38)
  • T to C, chromosome 14 at 34,374,517 bp (GRCm38)
  • T to C, chromosome 15 at 34,410,179 bp (GRCm38)
  • A to G, chromosome 15 at 66,933,862 bp (GRCm38)
  • A to T, chromosome 16 at 97,500,911 bp (GRCm38)
  • T to A, chromosome 17 at 12,619,870 bp (GRCm38)
  • T to C, chromosome 17 at 33,067,520 bp (GRCm38)
  • A to G, chromosome 17 at 43,087,910 bp (GRCm38)
  • T to G, chromosome 18 at 67,429,196 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9220 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069056-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.