Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9244Btlr/Mmmh
Stock Number:
069070-MU
Citation ID:
RRID:MMRRC_069070-MU
Other Names:
R9244 (G1)
Major Collection:

Strain Information

Chrnb3
Name: cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms: Acrb3, 5730417K16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108043
HGNC: HGNC:1963
Homologene: 36035
App
Name: amyloid beta precursor protein
Synonyms: betaAPP, Abeta, protease nexin II, Adap, Cvap, appican, E030013M08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11820
VEGA: 16
HGNC: HGNC:620
Homologene: 56379
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Esco2
Name: establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms: D030072L07Rik, 2410004I17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71988
Homologene: 12432
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 9,915,610 bp (GRCm38)
  • T to C, chromosome 1 at 40,619,089 bp (GRCm38)
  • A to G, chromosome 1 at 132,937,320 bp (GRCm38)
  • T to C, chromosome 1 at 132,937,499 bp (GRCm38)
  • A to G, chromosome 1 at 165,543,110 bp (GRCm38)
  • A to G, chromosome 2 at 36,240,712 bp (GRCm38)
  • A to T, chromosome 2 at 86,423,079 bp (GRCm38)
  • A to G, chromosome 2 at 91,712,695 bp (GRCm38)
  • A to C, chromosome 2 at 121,334,451 bp (GRCm38)
  • G to T, chromosome 2 at 125,655,669 bp (GRCm38)
  • G to T, chromosome 2 at 157,836,663 bp (GRCm38)
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp (GRCm38)
  • C to A, chromosome 3 at 32,741,757 bp (GRCm38)
  • T to A, chromosome 3 at 95,490,568 bp (GRCm38)
  • A to G, chromosome 3 at 141,827,609 bp (GRCm38)
  • A to T, chromosome 4 at 57,254,915 bp (GRCm38)
  • T to C, chromosome 4 at 101,157,843 bp (GRCm38)
  • T to C, chromosome 4 at 137,329,080 bp (GRCm38)
  • A to G, chromosome 5 at 9,410,700 bp (GRCm38)
  • T to C, chromosome 5 at 21,915,153 bp (GRCm38)
  • T to C, chromosome 5 at 73,191,519 bp (GRCm38)
  • A to G, chromosome 5 at 84,117,582 bp (GRCm38)
  • A to C, chromosome 5 at 106,874,900 bp (GRCm38)
  • A to G, chromosome 5 at 107,508,504 bp (GRCm38)
  • T to A, chromosome 6 at 42,471,603 bp (GRCm38)
  • C to A, chromosome 6 at 88,222,902 bp (GRCm38)
  • G to A, chromosome 6 at 116,515,821 bp (GRCm38)
  • A to T, chromosome 6 at 128,815,282 bp (GRCm38)
  • T to C, chromosome 7 at 3,822,227 bp (GRCm38)
  • A to G, chromosome 7 at 24,140,494 bp (GRCm38)
  • A to G, chromosome 7 at 105,389,663 bp (GRCm38)
  • A to G, chromosome 7 at 108,172,645 bp (GRCm38)
  • T to G, chromosome 7 at 132,983,911 bp (GRCm38)
  • A to G, chromosome 8 at 26,071,056 bp (GRCm38)
  • T to A, chromosome 8 at 27,394,566 bp (GRCm38)
  • A to T, chromosome 9 at 63,142,242 bp (GRCm38)
  • T to C, chromosome 10 at 24,778,791 bp (GRCm38)
  • C to A, chromosome 10 at 60,413,663 bp (GRCm38)
  • A to G, chromosome 10 at 128,282,765 bp (GRCm38)
  • A to G, chromosome 11 at 9,291,577 bp (GRCm38)
  • T to C, chromosome 11 at 29,513,271 bp (GRCm38)
  • T to C, chromosome 11 at 77,692,649 bp (GRCm38)
  • T to C, chromosome 13 at 22,827,919 bp (GRCm38)
  • A to T, chromosome 13 at 27,350,999 bp (GRCm38)
  • G to A, chromosome 13 at 74,673,784 bp (GRCm38)
  • T to C, chromosome 14 at 31,497,809 bp (GRCm38)
  • C to A, chromosome 14 at 53,370,547 bp (GRCm38)
  • A to T, chromosome 14 at 55,634,342 bp (GRCm38)
  • A to G, chromosome 14 at 65,821,639 bp (GRCm38)
  • G to A, chromosome 14 at 67,759,114 bp (GRCm38)
  • A to C, chromosome 16 at 22,068,151 bp (GRCm38)
  • G to T, chromosome 16 at 64,926,494 bp (GRCm38)
  • A to G, chromosome 16 at 84,962,741 bp (GRCm38)
  • A to G, chromosome 16 at 96,154,183 bp (GRCm38)
  • G to A, chromosome 16 at 96,685,229 bp (GRCm38)
  • T to A, chromosome 17 at 18,451,927 bp (GRCm38)
  • T to A, chromosome 17 at 23,477,615 bp (GRCm38)
  • C to A, chromosome 17 at 29,347,652 bp (GRCm38)
  • T to C, chromosome 18 at 25,115,865 bp (GRCm38)
  • T to A, chromosome 18 at 49,893,249 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9244 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069070-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.