Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9253Btlr/Mmmh
Stock Number:
069076-MU
Citation ID:
RRID:MMRRC_069076-MU
Other Names:
R9253 (G1)
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Ndufv1
Name: NADH:ubiquinone oxidoreductase core subunit V1
Synonyms: 24 kDa (FP)
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17995
HGNC: HGNC:7716
Homologene: 5151
Plcd3
Name: phospholipase C, delta 3
Synonyms: 2610205J15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72469
HGNC: HGNC:9061
Homologene: 14858
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: HMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
Nsf
Name: N-ethylmaleimide sensitive fusion protein
Synonyms: SKD2, N-ethylmaleimide sensitive factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18195
HGNC: HGNC:8016
Homologene: 4502
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 89,954,463 bp (GRCm38)
  • C to A, chromosome 1 at 91,540,829 bp (GRCm38)
  • T to C, chromosome 1 at 128,351,527 bp (GRCm38)
  • T to C, chromosome 2 at 25,577,160 bp (GRCm38)
  • A to T, chromosome 2 at 29,795,421 bp (GRCm38)
  • T to A, chromosome 2 at 30,371,227 bp (GRCm38)
  • G to A, chromosome 2 at 65,151,159 bp (GRCm38)
  • T to A, chromosome 2 at 76,732,607 bp (GRCm38)
  • T to C, chromosome 2 at 121,302,342 bp (GRCm38)
  • G to T, chromosome 2 at 162,947,712 bp (GRCm38)
  • A to G, chromosome 3 at 89,443,705 bp (GRCm38)
  • T to C, chromosome 3 at 96,528,394 bp (GRCm38)
  • C to A, chromosome 3 at 127,598,779 bp (GRCm38)
  • A to T, chromosome 3 at 138,424,099 bp (GRCm38)
  • T to C, chromosome 4 at 68,792,846 bp (GRCm38)
  • G to T, chromosome 5 at 38,672,258 bp (GRCm38)
  • A to G, chromosome 5 at 77,345,377 bp (GRCm38)
  • T to C, chromosome 5 at 134,901,790 bp (GRCm38)
  • T to C, chromosome 6 at 5,769,698 bp (GRCm38)
  • C to T, chromosome 6 at 46,001,178 bp (GRCm38)
  • G to A, chromosome 6 at 89,357,540 bp (GRCm38)
  • C to A, chromosome 6 at 123,123,649 bp (GRCm38)
  • T to A, chromosome 6 at 123,840,001 bp (GRCm38)
  • A to T, chromosome 7 at 20,911,892 bp (GRCm38)
  • T to C, chromosome 7 at 127,707,231 bp (GRCm38)
  • A to C, chromosome 8 at 80,719,715 bp (GRCm38)
  • T to A, chromosome 8 at 94,622,993 bp (GRCm38)
  • T to C, chromosome 8 at 128,502,663 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • G to A, chromosome 10 at 51,481,767 bp (GRCm38)
  • T to A, chromosome 10 at 79,293,748 bp (GRCm38)
  • T to C, chromosome 10 at 82,151,386 bp (GRCm38)
  • G to A, chromosome 11 at 21,308,771 bp (GRCm38)
  • T to C, chromosome 11 at 49,148,995 bp (GRCm38)
  • T to A, chromosome 11 at 55,310,571 bp (GRCm38)
  • C to A, chromosome 11 at 72,848,637 bp (GRCm38)
  • C to T, chromosome 11 at 95,868,350 bp (GRCm38)
  • T to C, chromosome 11 at 97,525,551 bp (GRCm38)
  • T to C, chromosome 11 at 103,079,634 bp (GRCm38)
  • C to T, chromosome 11 at 103,913,316 bp (GRCm38)
  • T to C, chromosome 11 at 119,321,933 bp (GRCm38)
  • A to G, chromosome 12 at 113,050,517 bp (GRCm38)
  • T to C, chromosome 13 at 33,671,222 bp (GRCm38)
  • C to T, chromosome 13 at 96,660,137 bp (GRCm38)
  • C to T, chromosome 13 at 97,988,271 bp (GRCm38)
  • T to C, chromosome 13 at 98,637,295 bp (GRCm38)
  • G to T, chromosome 14 at 20,666,670 bp (GRCm38)
  • A to G, chromosome 15 at 4,735,197 bp (GRCm38)
  • A to T, chromosome 15 at 63,804,558 bp (GRCm38)
  • A to G, chromosome 15 at 89,167,812 bp (GRCm38)
  • A to G, chromosome 15 at 100,783,032 bp (GRCm38)
  • A to G, chromosome 16 at 7,294,109 bp (GRCm38)
  • T to C, chromosome 16 at 14,117,308 bp (GRCm38)
  • T to A, chromosome 16 at 14,256,495 bp (GRCm38)
  • T to C, chromosome 17 at 34,267,404 bp (GRCm38)
  • A to T, chromosome 17 at 37,672,746 bp (GRCm38)
  • C to T, chromosome 17 at 40,208,342 bp (GRCm38)
  • T to G, chromosome 17 at 50,608,099 bp (GRCm38)
  • A to G, chromosome 17 at 78,827,994 bp (GRCm38)
  • A to T, chromosome 18 at 37,421,476 bp (GRCm38)
  • A to G, chromosome 18 at 58,969,941 bp (GRCm38)
  • T to A, chromosome 19 at 3,915,315 bp (GRCm38)
  • G to T, chromosome 19 at 4,009,412 bp (GRCm38)
  • T to C, chromosome X at 101,308,784 bp (GRCm38)
  • TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG to TGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAGAGGCAG, chromosome X at 101,793,311 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9253 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069076-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.