Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9259Btlr/Mmmh
Stock Number:
069081-MU
Citation ID:
RRID:MMRRC_069081-MU
Other Names:
R9259 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Fkbp2
Name: FK506 binding protein 2
Synonyms: mFKBP13, mFKBP2, 13kDa
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14227
VEGA: 19
HGNC: HGNC:3718
Homologene: 40604
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Gstt2
Name: glutathione S-transferase, theta 2
Synonyms: mGSTT2, Yrs
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14872
VEGA: 10
Homologene: 37358
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-gamma, Frabin-beta, Frabin-alpha, Frabin, 9330209B17Rik, ZFYVE6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224014
Homologene: 26727
Atp5mc2
Name: ATP synthase membrane subunit c locus 2
Synonyms: 1810041M08Rik, Atp5g2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67942
HGNC: HGNC:842
Homologene: 57052
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 165,310,456 bp (GRCm38)
  • T to C, chromosome 2 at 11,779,721 bp (GRCm38)
  • C to T, chromosome 2 at 25,398,602 bp (GRCm38)
  • T to A, chromosome 3 at 14,481,316 bp (GRCm38)
  • T to C, chromosome 3 at 100,472,324 bp (GRCm38)
  • T to C, chromosome 3 at 105,986,567 bp (GRCm38)
  • G to C, chromosome 3 at 129,926,421 bp (GRCm38)
  • C to T, chromosome 3 at 151,749,238 bp (GRCm38)
  • C to T, chromosome 4 at 41,118,229 bp (GRCm38)
  • T to C, chromosome 4 at 72,852,443 bp (GRCm38)
  • T to A, chromosome 4 at 76,071,963 bp (GRCm38)
  • C to A, chromosome 4 at 154,346,068 bp (GRCm38)
  • T to C, chromosome 4 at 155,891,182 bp (GRCm38)
  • C to T, chromosome 4 at 156,219,150 bp (GRCm38)
  • A to T, chromosome 6 at 40,884,035 bp (GRCm38)
  • A to G, chromosome 6 at 85,667,891 bp (GRCm38)
  • C to A, chromosome 6 at 123,235,465 bp (GRCm38)
  • A to G, chromosome 7 at 24,997,531 bp (GRCm38)
  • C to T, chromosome 7 at 27,367,699 bp (GRCm38)
  • A to G, chromosome 7 at 30,298,950 bp (GRCm38)
  • A to G, chromosome 7 at 43,574,856 bp (GRCm38)
  • A to G, chromosome 7 at 81,093,554 bp (GRCm38)
  • A to T, chromosome 7 at 98,593,550 bp (GRCm38)
  • A to G, chromosome 7 at 119,857,829 bp (GRCm38)
  • A to G, chromosome 7 at 120,174,055 bp (GRCm38)
  • G to C, chromosome 8 at 61,353,804 bp (GRCm38)
  • A to T, chromosome 8 at 70,077,935 bp (GRCm38)
  • C to T, chromosome 9 at 38,658,346 bp (GRCm38)
  • A to T, chromosome 9 at 106,241,636 bp (GRCm38)
  • A to C, chromosome 10 at 42,823,941 bp (GRCm38)
  • A to G, chromosome 10 at 63,061,657 bp (GRCm38)
  • A to G, chromosome 10 at 75,746,742 bp (GRCm38)
  • C to T, chromosome 10 at 75,833,677 bp (GRCm38)
  • A to T, chromosome 10 at 80,723,827 bp (GRCm38)
  • A to G, chromosome 10 at 85,939,061 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • A to G, chromosome 10 at 127,350,975 bp (GRCm38)
  • A to T, chromosome 11 at 46,770,491 bp (GRCm38)
  • A to T, chromosome 11 at 69,320,839 bp (GRCm38)
  • A to G, chromosome 11 at 87,779,524 bp (GRCm38)
  • G to A, chromosome 11 at 96,271,936 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • T to A, chromosome 12 at 36,003,864 bp (GRCm38)
  • A to T, chromosome 12 at 80,851,256 bp (GRCm38)
  • A to G, chromosome 12 at 84,109,042 bp (GRCm38)
  • A to G, chromosome 12 at 110,931,433 bp (GRCm38)
  • G to A, chromosome 13 at 89,690,870 bp (GRCm38)
  • A to T, chromosome 13 at 95,630,053 bp (GRCm38)
  • G to A, chromosome 13 at 104,223,104 bp (GRCm38)
  • G to T, chromosome 14 at 34,741,095 bp (GRCm38)
  • T to A, chromosome 14 at 76,417,044 bp (GRCm38)
  • G to A, chromosome 14 at 78,512,509 bp (GRCm38)
  • T to C, chromosome 15 at 8,203,303 bp (GRCm38)
  • T to C, chromosome 15 at 58,323,075 bp (GRCm38)
  • A to T, chromosome 15 at 64,704,755 bp (GRCm38)
  • A to T, chromosome 15 at 94,558,845 bp (GRCm38)
  • T to A, chromosome 15 at 102,663,126 bp (GRCm38)
  • C to T, chromosome 16 at 16,225,850 bp (GRCm38)
  • T to C, chromosome 16 at 16,477,461 bp (GRCm38)
  • G to A, chromosome 17 at 29,491,207 bp (GRCm38)
  • G to T, chromosome 17 at 33,882,191 bp (GRCm38)
  • T to C, chromosome 17 at 45,425,891 bp (GRCm38)
  • T to C, chromosome 19 at 4,934,458 bp (GRCm38)
  • G to T, chromosome 19 at 6,978,592 bp (GRCm38)
  • G to T, chromosome 19 at 44,517,416 bp (GRCm38)
  • A to G, chromosome Y at 942,640 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9259 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069081-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.