Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9259Btlr/Mmmh
Stock Number:
069081-MU
Citation ID:
RRID:MMRRC_069081-MU
Other Names:
R9259 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Fkbp2
Name: FK506 binding protein 2
Synonyms: mFKBP13, mFKBP2, 13kDa
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14227
VEGA: 19
HGNC: HGNC:3718
Homologene: 40604
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Gstt2
Name: glutathione S-transferase, theta 2
Synonyms: mGSTT2, Yrs
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14872
VEGA: 10
Homologene: 37358
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-gamma, Frabin-beta, Frabin-alpha, Frabin, 9330209B17Rik, ZFYVE6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224014
Homologene: 26727
Atp5mc2
Name: ATP synthase membrane subunit c locus 2
Synonyms: 1810041M08Rik, Atp5g2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67942
HGNC: HGNC:842
Homologene: 57052
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Cabin1
Name: calcineurin binding protein 1
Synonyms: Ppp3in, Cain, A330070M20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Dcun1d3
Name: defective in cullin neddylation 1 domain containing 3
Synonyms: 1700020A13Rik, DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233805
Homologene: 16155
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: TSC-22, Egr5, Tgfb1i4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Iqgap2
Name: IQ motif containing GTPase activating protein 2
Synonyms: 4933417J23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544963
VEGA: 13
HGNC: HGNC:6111
Homologene: 101543
Emsy
Name: EMSY, BRCA2-interacting transcriptional repressor
Synonyms: 2210018M11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233545
Homologene: 32465
Wapl
Name: WAPL cohesin release factor
Synonyms: A530089A20Rik, Wapal
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218914
Homologene: 41002
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, 2610108D09Rik, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Irak4
Name: interleukin-1 receptor-associated kinase 4
Synonyms: NY-REN-64, IRAK-4, 9330209D03Rik, 8430405M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 266632
Homologene: 41109
Nol6
Name: nucleolar protein family 6 (RNA-associated)
Synonyms: Nrap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230082
Homologene: 41505
Cntrob
Name: centrobin, centrosomal BRCA2 interacting protein
Synonyms: Lip8, 9830165K03Rik, Nip2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216846
Homologene: 14205
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Kifc1
Name: kinesin family member C1
Synonyms: Tctex-7, Tctex-7A, Tctex7, Tctex7a, kinesin family c-terminal 5A, HSET, KNSL2, Kifc5a, Gm4137, Knsl2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100502766
HGNC: HGNC:6389
Homologene: 83229
Havcr1
Name: hepatitis A virus cellular receptor 1
Synonyms: Tim1, TIM-1, KIM-1, Timd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171283
Homologene: 136301
Alas1
Name: aminolevulinic acid synthase 1
Synonyms: 5-aminolevulinate synthase, succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11655
HGNC: HGNC:396
Homologene: 55478
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Sec63
Name: SEC63 homolog, protein translocation regulator
Synonyms: 5730478J10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140740
Homologene: 5220
Ppwd1
Name: peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms: A330090G21Rik, 4632422M10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238831
VEGA: 13
Homologene: 9099
Susd6
Name: sushi domain containing 6
Synonyms: 4933426M11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217684
VEGA: 12
Homologene: 40980
Akap11
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Pkp2
Name: plakophilin 2
Synonyms: 1200012P04Rik, 1200008D14Rik, Pkp2l
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67451
HGNC: HGNC:9024
Homologene: 3364
Sec31b
Name: SEC31 homolog B, COPII coat complex component
Synonyms: LOC240667, Sec31l2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240667
Homologene: 56708
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Kdm5d
Name: lysine demethylase 5D
Synonyms: Smcy, Jarid1d, HY
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 20592
Homologene: 55838
Sh3rf1
Name: SH3 domain containing ring finger 1
Synonyms: Posh, 2200003J05Rik, Sh3md2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59009
Homologene: 10988
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Rtcb
Name: RNA 2',3'-cyclic phosphate and 5'-OH ligase
Synonyms: HSPC117, D10Wsu52e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28088
Homologene: 36344
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Tent5c
Name: terminal nucleotidyltransferase 5C
Synonyms: 4930431B09Rik, Fam46c
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74645
Homologene: 56783
Pbld1
Name: phenazine biosynthesis-like protein domain containing 1
Synonyms: 0610038K03Rik, Pbld
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68371
VEGA: 10
Homologene: 41470
Zfp175
Name: zinc finger protein 175
Synonyms: Zfp658
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210104
Homologene: 134007
Aldoart1
Name: aldolase 1 A, retrogene 1
Synonyms: Aldo1-ps2, 4921524E03Rik, Aldoa-ps2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 353204
Homologene: 128442
Tm6sf2
Name: transmembrane 6 superfamily member 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 107770
Homologene: 77694
Clip3
Name: CAP-GLY domain containing linker protein 3
Synonyms: 1500005P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76686
Homologene: 9176
Ifi44
Name: interferon-induced protein 44
Synonyms: p44, MTAP44, A430056A10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99899
Homologene: 4683
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Ankrd16
Name: ankyrin repeat domain 16
Synonyms: D430029B21Rik, 2810455F06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320816
Homologene: 19509
Acot6
Name: acyl-CoA thioesterase 6
Synonyms: 4632408A20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217700
Homologene: 72506
Gpr161
Name: G protein-coupled receptor 161
Synonyms: LOC240888, vl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240888
Homologene: 17824
Anks4b
Name: ankyrin repeat and sterile alpha motif domain containing 4B
Synonyms: Harp, 2010013E14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72074
Homologene: 49898
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Pim1
Name: proviral integration site 1
Synonyms: Pim-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18712
HGNC: HGNC:8986
Homologene: 11214
Or8b51
Name: olfactory receptor family 8 subfamily B member 51
Synonyms: GA_x6K02T2PVTD-32360710-32359778, MOR168-1, Olfr916
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258780
VEGA: 9
Homologene: 74147
Peli3
Name: pellino 3
Synonyms: 6030441F14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240518
Homologene: 27059
Inhbe
Name: inhibin beta-E
Synonyms: activin beta-E, activin betaE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16326
VEGA: 10
Homologene: 7381
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: dectin-2, Clecsf10, Nkcl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56620
Homologene: 84615
Entpd2
Name: ectonucleoside triphosphate diphosphohydrolase 2
Synonyms: NTPDase2, Cd39l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12496
HGNC: HGNC:3364
Homologene: 20333
Slc7a12
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 12
Synonyms: asc-type amino acid transporter 2, Asc-2, XAT1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140918
Homologene: 76812
Hoxb9
Name: homeobox B9
Synonyms: Hox-2.5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15417
HGNC: HGNC:5120
Homologene: 7367
Klhl38
Name: kelch-like 38
Synonyms: 8230402K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268807
Homologene: 18622
Pusl1
Name: pseudouridylate synthase-like 1
Synonyms: 2810021I11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433813
Homologene: 13655
Agr2
Name: anterior gradient 2
Synonyms: mAG-2, Gob-4, XAG-2, HAG-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23795
HGNC: HGNC:328
Homologene: 4674
Mcub
Name: mitochondrial calcium uniporter dominant negative beta subunit
Synonyms: 9030408N13Rik, Ccdc109b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66815
Homologene: 23056
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 165,310,456 bp (GRCm38)
  • T to C, chromosome 2 at 11,779,721 bp (GRCm38)
  • C to T, chromosome 2 at 25,398,602 bp (GRCm38)
  • T to A, chromosome 3 at 14,481,316 bp (GRCm38)
  • T to C, chromosome 3 at 100,472,324 bp (GRCm38)
  • T to C, chromosome 3 at 105,986,567 bp (GRCm38)
  • G to C, chromosome 3 at 129,926,421 bp (GRCm38)
  • C to T, chromosome 3 at 151,749,238 bp (GRCm38)
  • C to T, chromosome 4 at 41,118,229 bp (GRCm38)
  • T to C, chromosome 4 at 72,852,443 bp (GRCm38)
  • T to A, chromosome 4 at 76,071,963 bp (GRCm38)
  • C to A, chromosome 4 at 154,346,068 bp (GRCm38)
  • T to C, chromosome 4 at 155,891,182 bp (GRCm38)
  • C to T, chromosome 4 at 156,219,150 bp (GRCm38)
  • A to T, chromosome 6 at 40,884,035 bp (GRCm38)
  • A to G, chromosome 6 at 85,667,891 bp (GRCm38)
  • C to A, chromosome 6 at 123,235,465 bp (GRCm38)
  • A to G, chromosome 7 at 24,997,531 bp (GRCm38)
  • C to T, chromosome 7 at 27,367,699 bp (GRCm38)
  • A to G, chromosome 7 at 30,298,950 bp (GRCm38)
  • A to G, chromosome 7 at 43,574,856 bp (GRCm38)
  • A to G, chromosome 7 at 81,093,554 bp (GRCm38)
  • A to T, chromosome 7 at 98,593,550 bp (GRCm38)
  • A to G, chromosome 7 at 119,857,829 bp (GRCm38)
  • A to G, chromosome 7 at 120,174,055 bp (GRCm38)
  • G to C, chromosome 8 at 61,353,804 bp (GRCm38)
  • A to T, chromosome 8 at 70,077,935 bp (GRCm38)
  • C to T, chromosome 9 at 38,658,346 bp (GRCm38)
  • A to T, chromosome 9 at 106,241,636 bp (GRCm38)
  • A to C, chromosome 10 at 42,823,941 bp (GRCm38)
  • A to G, chromosome 10 at 63,061,657 bp (GRCm38)
  • A to G, chromosome 10 at 75,746,742 bp (GRCm38)
  • C to T, chromosome 10 at 75,833,677 bp (GRCm38)
  • A to T, chromosome 10 at 80,723,827 bp (GRCm38)
  • A to G, chromosome 10 at 85,939,061 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • A to G, chromosome 10 at 127,350,975 bp (GRCm38)
  • A to T, chromosome 11 at 46,770,491 bp (GRCm38)
  • A to T, chromosome 11 at 69,320,839 bp (GRCm38)
  • A to G, chromosome 11 at 87,779,524 bp (GRCm38)
  • G to A, chromosome 11 at 96,271,936 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • T to A, chromosome 12 at 36,003,864 bp (GRCm38)
  • A to T, chromosome 12 at 80,851,256 bp (GRCm38)
  • A to G, chromosome 12 at 84,109,042 bp (GRCm38)
  • A to G, chromosome 12 at 110,931,433 bp (GRCm38)
  • G to A, chromosome 13 at 89,690,870 bp (GRCm38)
  • A to T, chromosome 13 at 95,630,053 bp (GRCm38)
  • G to A, chromosome 13 at 104,223,104 bp (GRCm38)
  • G to T, chromosome 14 at 34,741,095 bp (GRCm38)
  • T to A, chromosome 14 at 76,417,044 bp (GRCm38)
  • G to A, chromosome 14 at 78,512,509 bp (GRCm38)
  • T to C, chromosome 15 at 8,203,303 bp (GRCm38)
  • T to C, chromosome 15 at 58,323,075 bp (GRCm38)
  • A to T, chromosome 15 at 64,704,755 bp (GRCm38)
  • A to T, chromosome 15 at 94,558,845 bp (GRCm38)
  • T to A, chromosome 15 at 102,663,126 bp (GRCm38)
  • C to T, chromosome 16 at 16,225,850 bp (GRCm38)
  • T to C, chromosome 16 at 16,477,461 bp (GRCm38)
  • G to A, chromosome 17 at 29,491,207 bp (GRCm38)
  • G to T, chromosome 17 at 33,882,191 bp (GRCm38)
  • T to C, chromosome 17 at 45,425,891 bp (GRCm38)
  • T to C, chromosome 19 at 4,934,458 bp (GRCm38)
  • G to T, chromosome 19 at 6,978,592 bp (GRCm38)
  • G to T, chromosome 19 at 44,517,416 bp (GRCm38)
  • A to G, chromosome Y at 942,640 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9259 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069081-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.