Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9292Btlr/Mmmh
Stock Number:
069111-MU
Citation ID:
RRID:MMRRC_069111-MU
Other Names:
R9292 (G1)
Major Collection:

Strain Information

Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Swt1
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66875
Homologene: 32355
Eif4g3
Name: eukaryotic translation initiation factor 4 gamma, 3
Synonyms: eIF4GII, 1500002J22Rik, 4930523M17Rik, G1-419-52, repro8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230861
HGNC: HGNC:3298
Homologene: 2789
Gtf2a1
Name: general transcription factor II A, 1
Synonyms: TfIIAa/b, 19kDa, 37kDa, 6330549H03Rik, Tfiia1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 83602
HGNC: HGNC:4646
Homologene: 56331
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 6,827,882 bp (GRCm38)
  • T to A, chromosome 1 at 55,071,709 bp (GRCm38)
  • T to A, chromosome 1 at 80,213,504 bp (GRCm38)
  • T to C, chromosome 1 at 151,403,036 bp (GRCm38)
  • T to C, chromosome 1 at 161,844,005 bp (GRCm38)
  • T to C, chromosome 1 at 172,215,547 bp (GRCm38)
  • C to T, chromosome 1 at 173,203,532 bp (GRCm38)
  • A to G, chromosome 2 at 80,346,572 bp (GRCm38)
  • T to C, chromosome 2 at 117,175,351 bp (GRCm38)
  • C to T, chromosome 2 at 121,215,696 bp (GRCm38)
  • T to C, chromosome 2 at 125,975,298 bp (GRCm38)
  • G to A, chromosome 2 at 155,990,768 bp (GRCm38)
  • T to A, chromosome 3 at 14,107,252 bp (GRCm38)
  • T to C, chromosome 4 at 56,926,173 bp (GRCm38)
  • T to C, chromosome 4 at 56,937,979 bp (GRCm38)
  • T to C, chromosome 4 at 58,486,558 bp (GRCm38)
  • A to G, chromosome 4 at 138,194,071 bp (GRCm38)
  • A to T, chromosome 4 at 147,674,638 bp (GRCm38)
  • C to T, chromosome 5 at 8,812,843 bp (GRCm38)
  • T to C, chromosome 5 at 108,388,885 bp (GRCm38)
  • T to A, chromosome 5 at 138,301,450 bp (GRCm38)
  • T to C, chromosome 6 at 90,591,885 bp (GRCm38)
  • A to C, chromosome 6 at 91,074,253 bp (GRCm38)
  • T to C, chromosome 7 at 27,539,454 bp (GRCm38)
  • A to G, chromosome 7 at 100,636,756 bp (GRCm38)
  • T to C, chromosome 7 at 105,753,913 bp (GRCm38)
  • T to C, chromosome 7 at 125,674,391 bp (GRCm38)
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp (GRCm38)
  • T to A, chromosome 8 at 13,370,580 bp (GRCm38)
  • T to A, chromosome 9 at 38,657,775 bp (GRCm38)
  • A to T, chromosome 9 at 79,678,523 bp (GRCm38)
  • T to A, chromosome 10 at 80,804,726 bp (GRCm38)
  • T to A, chromosome 10 at 87,567,356 bp (GRCm38)
  • C to A, chromosome 11 at 5,865,260 bp (GRCm38)
  • T to C, chromosome 11 at 75,515,180 bp (GRCm38)
  • G to T, chromosome 12 at 75,951,049 bp (GRCm38)
  • A to G, chromosome 12 at 76,405,273 bp (GRCm38)
  • G to A, chromosome 12 at 91,568,190 bp (GRCm38)
  • G to A, chromosome 12 at 109,590,239 bp (GRCm38)
  • T to G, chromosome 13 at 20,600,259 bp (GRCm38)
  • A to G, chromosome 13 at 73,784,588 bp (GRCm38)
  • T to A, chromosome 14 at 27,776,842 bp (GRCm38)
  • C to G, chromosome 14 at 40,815,957 bp (GRCm38)
  • T to C, chromosome 14 at 50,619,056 bp (GRCm38)
  • T to C, chromosome 15 at 76,466,831 bp (GRCm38)
  • T to C, chromosome 15 at 102,326,448 bp (GRCm38)
  • T to A, chromosome 16 at 29,422,682 bp (GRCm38)
  • T to C, chromosome 17 at 12,927,368 bp (GRCm38)
  • A to G, chromosome 17 at 27,473,063 bp (GRCm38)
  • T to A, chromosome 17 at 28,363,764 bp (GRCm38)
  • T to G, chromosome 17 at 37,055,892 bp (GRCm38)
  • C to A, chromosome 17 at 75,276,441 bp (GRCm38)
  • T to A, chromosome 18 at 20,283,718 bp (GRCm38)
  • A to T, chromosome 18 at 37,686,660 bp (GRCm38)
  • T to C, chromosome 18 at 44,015,008 bp (GRCm38)
  • T to C, chromosome 19 at 3,897,840 bp (GRCm38)
  • G to A, chromosome 19 at 4,938,089 bp (GRCm38)
  • A to T, chromosome 19 at 6,964,674 bp (GRCm38)
  • A to G, chromosome 19 at 25,183,631 bp (GRCm38)
  • C to A, chromosome 19 at 29,628,649 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9292 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069111-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.