Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9340Btlr/Mmmh
Stock Number:
069151-MU
Citation ID:
RRID:MMRRC_069151-MU
Other Names:
R9340 (G1)
Major Collection:

Strain Information

Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117599
Homologene: 50463
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 167,631,321 bp (GRCm38)
  • G to A, chromosome 2 at 34,986,282 bp (GRCm38)
  • G to A, chromosome 2 at 54,880,149 bp (GRCm38)
  • T to A, chromosome 2 at 71,262,675 bp (GRCm38)
  • A to G, chromosome 2 at 82,988,260 bp (GRCm38)
  • T to C, chromosome 2 at 121,269,979 bp (GRCm38)
  • T to C, chromosome 2 at 150,003,255 bp (GRCm38)
  • CACCTGCAGGCAGTGCCAGAGCTACGCCAAGCTCCGGACCTGCAGG to CACCTGCAGG, chromosome 2 at 164,791,929 bp (GRCm38)
  • A to T, chromosome 2 at 172,426,766 bp (GRCm38)
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp (GRCm38)
  • C to T, chromosome 3 at 122,504,813 bp (GRCm38)
  • T to C, chromosome 4 at 61,594,396 bp (GRCm38)
  • T to C, chromosome 4 at 120,930,816 bp (GRCm38)
  • C to A, chromosome 4 at 126,323,159 bp (GRCm38)
  • T to G, chromosome 4 at 137,569,516 bp (GRCm38)
  • T to A, chromosome 4 at 139,455,452 bp (GRCm38)
  • T to C, chromosome 4 at 147,674,241 bp (GRCm38)
  • A to G, chromosome 5 at 32,147,035 bp (GRCm38)
  • T to C, chromosome 5 at 74,597,923 bp (GRCm38)
  • G to T, chromosome 5 at 97,938,447 bp (GRCm38)
  • A to T, chromosome 5 at 135,217,875 bp (GRCm38)
  • C to A, chromosome 6 at 82,913,909 bp (GRCm38)
  • T to C, chromosome 7 at 15,396,864 bp (GRCm38)
  • A to T, chromosome 7 at 15,833,797 bp (GRCm38)
  • A to G, chromosome 7 at 46,701,824 bp (GRCm38)
  • T to C, chromosome 7 at 101,388,175 bp (GRCm38)
  • T to A, chromosome 7 at 130,180,406 bp (GRCm38)
  • C to A, chromosome 7 at 139,389,464 bp (GRCm38)
  • A to G, chromosome 8 at 25,886,758 bp (GRCm38)
  • C to T, chromosome 8 at 104,182,107 bp (GRCm38)
  • A to G, chromosome 8 at 119,613,030 bp (GRCm38)
  • T to C, chromosome 8 at 123,938,142 bp (GRCm38)
  • C to T, chromosome 9 at 22,157,834 bp (GRCm38)
  • C to T, chromosome 9 at 105,774,558 bp (GRCm38)
  • T to C, chromosome 9 at 114,631,829 bp (GRCm38)
  • A to G, chromosome 9 at 119,428,426 bp (GRCm38)
  • A to G, chromosome 10 at 13,506,774 bp (GRCm38)
  • T to C, chromosome 10 at 120,092,651 bp (GRCm38)
  • C to T, chromosome 11 at 72,037,427 bp (GRCm38)
  • T to A, chromosome 11 at 79,556,803 bp (GRCm38)
  • A to G, chromosome 11 at 109,950,113 bp (GRCm38)
  • G to A, chromosome 12 at 31,324,224 bp (GRCm38)
  • A to T, chromosome 12 at 31,324,225 bp (GRCm38)
  • A to G, chromosome 12 at 54,916,587 bp (GRCm38)
  • G to T, chromosome 12 at 75,633,163 bp (GRCm38)
  • T to A, chromosome 12 at 79,274,906 bp (GRCm38)
  • A to G, chromosome 12 at 83,487,675 bp (GRCm38)
  • T to C, chromosome 12 at 87,268,279 bp (GRCm38)
  • T to C, chromosome 12 at 105,218,720 bp (GRCm38)
  • A to T, chromosome 13 at 32,882,189 bp (GRCm38)
  • T to A, chromosome 13 at 60,853,833 bp (GRCm38)
  • A to G, chromosome 13 at 85,221,530 bp (GRCm38)
  • G to A, chromosome 13 at 100,315,986 bp (GRCm38)
  • G to A, chromosome 14 at 20,679,530 bp (GRCm38)
  • A to T, chromosome 14 at 49,048,840 bp (GRCm38)
  • A to C, chromosome 14 at 57,481,463 bp (GRCm38)
  • A to T, chromosome 19 at 8,775,272 bp (GRCm38)
  • A to T, chromosome 19 at 9,017,047 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9340 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069151-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.