Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9352Btlr/Mmmh
Stock Number:
069162-MU
Citation ID:
RRID:MMRRC_069162-MU
Other Names:
R9352 (G1)
Major Collection:

Strain Information

Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Chrnb4
Name: cholinergic receptor, nicotinic, beta polypeptide 4
Synonyms: Acrb-4, Acrb4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108015
VEGA: 9
HGNC: HGNC:1964
Homologene: 20196
Trib2
Name: tribbles pseudokinase 2
Synonyms: TRB2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217410
Homologene: 41445
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Srsf11
Name: serine and arginine-rich splicing factor 11
Synonyms: 0610009J05Rik, 2610019N13Rik, Sfrs11
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69207
Homologene: 36164
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 44,091,593 bp (GRCm38)
  • C to T, chromosome 1 at 74,713,761 bp (GRCm38)
  • A to G, chromosome 1 at 86,099,572 bp (GRCm38)
  • T to C, chromosome 1 at 188,972,580 bp (GRCm38)
  • T to C, chromosome 2 at 40,858,426 bp (GRCm38)
  • T to C, chromosome 2 at 122,451,041 bp (GRCm38)
  • T to C, chromosome 2 at 130,441,903 bp (GRCm38)
  • T to C, chromosome 2 at 146,953,007 bp (GRCm38)
  • A to G, chromosome 2 at 158,000,772 bp (GRCm38)
  • G to A, chromosome 2 at 164,900,322 bp (GRCm38)
  • A to G, chromosome 2 at 180,279,260 bp (GRCm38)
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp (GRCm38)
  • A to T, chromosome 3 at 106,160,471 bp (GRCm38)
  • A to T, chromosome 3 at 151,835,523 bp (GRCm38)
  • A to G, chromosome 3 at 158,012,199 bp (GRCm38)
  • CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC to CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC, chromosome 4 at 43,177,312 bp (GRCm38)
  • GAGCCA to GAGCCATAGCCA, chromosome 4 at 43,177,313 bp (GRCm38)
  • A to T, chromosome 4 at 129,317,705 bp (GRCm38)
  • G to T, chromosome 5 at 90,961,313 bp (GRCm38)
  • T to G, chromosome 5 at 137,436,483 bp (GRCm38)
  • T to A, chromosome 6 at 47,502,492 bp (GRCm38)
  • A to C, chromosome 6 at 67,426,608 bp (GRCm38)
  • C to T, chromosome 6 at 86,765,793 bp (GRCm38)
  • T to C, chromosome 6 at 149,334,682 bp (GRCm38)
  • T to A, chromosome 7 at 4,758,606 bp (GRCm38)
  • C to T, chromosome 7 at 19,144,674 bp (GRCm38)
  • T to C, chromosome 7 at 25,763,327 bp (GRCm38)
  • G to A, chromosome 7 at 45,628,856 bp (GRCm38)
  • A to T, chromosome 7 at 82,442,448 bp (GRCm38)
  • G to T, chromosome 7 at 105,749,674 bp (GRCm38)
  • C to A, chromosome 7 at 132,270,528 bp (GRCm38)
  • T to C, chromosome 8 at 11,505,504 bp (GRCm38)
  • T to C, chromosome 8 at 22,660,428 bp (GRCm38)
  • A to T, chromosome 8 at 26,011,091 bp (GRCm38)
  • A to T, chromosome 8 at 66,513,322 bp (GRCm38)
  • T to A, chromosome 9 at 15,722,023 bp (GRCm38)
  • A to G, chromosome 9 at 20,929,088 bp (GRCm38)
  • A to G, chromosome 9 at 37,897,416 bp (GRCm38)
  • T to G, chromosome 9 at 38,219,387 bp (GRCm38)
  • T to C, chromosome 9 at 42,337,851 bp (GRCm38)
  • T to A, chromosome 9 at 44,389,629 bp (GRCm38)
  • T to G, chromosome 9 at 51,141,244 bp (GRCm38)
  • T to A, chromosome 9 at 55,043,883 bp (GRCm38)
  • A to G, chromosome 9 at 110,206,152 bp (GRCm38)
  • T to A, chromosome 9 at 110,627,848 bp (GRCm38)
  • G to A, chromosome 9 at 119,972,931 bp (GRCm38)
  • G to A, chromosome 10 at 60,307,527 bp (GRCm38)
  • A to G, chromosome 10 at 88,432,488 bp (GRCm38)
  • T to C, chromosome 10 at 128,636,754 bp (GRCm38)
  • A to T, chromosome 10 at 129,501,495 bp (GRCm38)
  • T to C, chromosome 11 at 3,923,446 bp (GRCm38)
  • G to A, chromosome 11 at 4,160,494 bp (GRCm38)
  • A to G, chromosome 11 at 20,332,025 bp (GRCm38)
  • A to G, chromosome 11 at 73,940,644 bp (GRCm38)
  • A to G, chromosome 11 at 82,796,145 bp (GRCm38)
  • T to C, chromosome 11 at 106,989,466 bp (GRCm38)
  • T to A, chromosome 11 at 116,966,707 bp (GRCm38)
  • A to C, chromosome 12 at 15,815,412 bp (GRCm38)
  • A to G, chromosome 12 at 84,414,620 bp (GRCm38)
  • C to T, chromosome 12 at 103,330,439 bp (GRCm38)
  • T to A, chromosome 13 at 8,757,392 bp (GRCm38)
  • A to G, chromosome 13 at 23,706,136 bp (GRCm38)
  • A to T, chromosome 13 at 30,752,723 bp (GRCm38)
  • C to T, chromosome 13 at 73,973,681 bp (GRCm38)
  • G to T, chromosome 13 at 100,301,385 bp (GRCm38)
  • A to G, chromosome 13 at 100,803,872 bp (GRCm38)
  • G to T, chromosome 14 at 31,316,663 bp (GRCm38)
  • T to C, chromosome 14 at 41,486,361 bp (GRCm38)
  • T to C, chromosome 15 at 76,891,474 bp (GRCm38)
  • T to A, chromosome 15 at 83,306,926 bp (GRCm38)
  • T to C, chromosome 16 at 22,579,831 bp (GRCm38)
  • T to C, chromosome 16 at 37,041,890 bp (GRCm38)
  • A to T, chromosome 16 at 56,252,107 bp (GRCm38)
  • A to T, chromosome 17 at 20,965,237 bp (GRCm38)
  • A to G, chromosome 17 at 22,603,498 bp (GRCm38)
  • T to C, chromosome 17 at 33,242,361 bp (GRCm38)
  • T to G, chromosome 17 at 35,382,933 bp (GRCm38)
  • T to A, chromosome 17 at 40,767,309 bp (GRCm38)
  • T to G, chromosome 17 at 46,410,358 bp (GRCm38)
  • A to G, chromosome 17 at 58,092,468 bp (GRCm38)
  • A to G, chromosome 17 at 73,161,942 bp (GRCm38)
  • G to A, chromosome 17 at 74,658,352 bp (GRCm38)
  • C to T, chromosome 18 at 4,349,170 bp (GRCm38)
  • A to G, chromosome 18 at 21,076,374 bp (GRCm38)
  • G to A, chromosome 18 at 32,080,160 bp (GRCm38)
  • A to G, chromosome 18 at 57,389,245 bp (GRCm38)
  • C to A, chromosome 18 at 65,306,712 bp (GRCm38)
  • T to C, chromosome 18 at 89,474,009 bp (GRCm38)
  • C to T, chromosome 19 at 10,669,533 bp (GRCm38)
  • A to G, chromosome 19 at 44,943,518 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9352 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069162-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.