Strain Name:
C57BL/6J-MtgxR9352Btlr/Mmmh
Stock Number:
069162-MU
Citation ID:
RRID:MMRRC_069162-MU
Other Names:
R9352 (G1)
Major Collection:

Strain Information

Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Chrnb4
Name: cholinergic receptor, nicotinic, beta polypeptide 4
Synonyms: Acrb-4, Acrb4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108015
VEGA: 9
HGNC: HGNC:1964
Homologene: 20196
Trib2
Name: tribbles pseudokinase 2
Synonyms: TRB2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217410
Homologene: 41445
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MommeD2, Cxxc9, Dnmt1o, MTase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Zfp7
Name: zinc finger protein 7
Synonyms: KRAB20, KRAB7, Zfp65, mszf73-2, Krox-2, Zfp-7, Zfp80, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Srsf11
Name: serine and arginine-rich splicing factor 11
Synonyms: Sfrs11, 0610009J05Rik, 2610019N13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69207
Homologene: 36164
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Csrnp1
Name: cysteine-serine-rich nuclear protein 1
Synonyms: taip-3, 4931429D10Rik, CSRNP-1, Axud1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215418
VEGA: 9
Homologene: 13196
Anxa4
Name: annexin A4
Synonyms: annexin IV, Xanx-4, AIV, Anx4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11746
HGNC: HGNC:542
Homologene: 68164
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot/Tpl2, Tpl-2, Cot, Tpl2, c-COT
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: msp3, SRG3, BAF155
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Kpna2
Name: karyopherin subunit alpha 2
Synonyms: Importin alpha, m-importin-alpha-P1, 2410044B12Rik, Rch1, pendulin, importin alpha 1, m-importin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16647
HGNC: HGNC:6395
Homologene: 1708
Lig3
Name: ligase III, DNA, ATP-dependent
Synonyms: D11Wsu78e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16882
HGNC: HGNC:6600
Homologene: 32109
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Resf1
Name: retroelement silencing factor 1
Synonyms: 2810474O19Rik, GET
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Rbbp4
Name: retinoblastoma binding protein 4, chromatin remodeling factor
Synonyms: RBAP48, CAF-1 p48 subunit
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19646
HGNC: HGNC:9887
Homologene: 21153
Kctd3
Name: potassium channel tetramerisation domain containing 3
Synonyms: E330032J19Rik, 4930438A20Rik, NY-REN-45
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226823
Homologene: 9395
Fnta
Name: farnesyltransferase, CAAX box, alpha
Synonyms: FTA
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14272
HGNC: HGNC:3782
Homologene: 1534
Ppp2r1a
Name: protein phosphatase 2, regulatory subunit A, alpha
Synonyms: PP2A, 6330556D22Rik, protein phosphatase PP2A, PR65
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 51792
HGNC: HGNC:9302
Homologene: 68559
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, D530032D06Rik, 2610034E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57908
Homologene: 22808
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: 1810010K08Rik, ZTL1, Znt5, ZnT-5, Zntl1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Iws1
Name: IWS1, SUPT6 interacting protein
Synonyms: 1700069O15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73473
Homologene: 134421
Htr2b
Name: 5-hydroxytryptamine (serotonin) receptor 2B
Synonyms: 5-HT2B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15559
HGNC: HGNC:5294
Homologene: 55492
Arfgap3
Name: ADP-ribosylation factor GTPase activating protein 3
Synonyms: 1810035F16Rik, 0610009H19Rik, 1810004P07Rik, 9130416J18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66251
VEGA: 15
HGNC: HGNC:661
Homologene: 134103
Slf2
Name: SMC5-SMC6 complex localization factor 2
Synonyms: 6030443O07Rik, Fam178a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226151
VEGA: 19
Homologene: 23077
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Chst15
Name: carbohydrate sulfotransferase 15
Synonyms: GalNAcS-6ST, MAd5, MAd5, 4631426J05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77590
Homologene: 8908
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Lclat1
Name: lysocardiolipin acyltransferase 1
Synonyms: ALCAT1, Lycat, AGPAT8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225010
Homologene: 33167
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKK-2, IKK[b], IKK2, IKKbeta, IKK-beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Cul1
Name: cullin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26965
HGNC: HGNC:2551
Homologene: 2663
Naxd
Name: NAD(P)HX dehydratase
Synonyms: 2810407E01Rik, Carkd, 0710008K08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69225
Homologene: 6333
Tex30
Name: testis expressed 30
Synonyms: 1700029F09Rik, 3110030D08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75623
Homologene: 16344
Zdhhc11
Name: zinc finger, DHHC domain containing 11
Synonyms: 4933421L13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71164
VEGA: 13
Homologene: 128723
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268510
Homologene: 27821
Irf4
Name: interferon regulatory factor 4
Synonyms: Spip, IRF-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16364
HGNC: HGNC:6119
Homologene: 1842
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, B230373P09Rik, E030034C22Rik, G1-415-19, Dnahc1, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Sf3a1
Name: splicing factor 3a, subunit 1
Synonyms: 5930416L09Rik, 1200014H24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67465
Homologene: 4294
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: mdfw, ahl, nmf112, nmf252, 4930542A03Rik, nmf181, sals, USH1D, bob
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Mthfd2l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Synonyms: 1110019K23Rik, C630010D07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665563
Homologene: 28295
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269959
Homologene: 18912
Mep1b
Name: meprin 1 beta
Synonyms: meprin beta, Mep-1b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17288
VEGA: 18
HGNC: HGNC:7020
Homologene: 48382
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Dgkg
Name: diacylglycerol kinase, gamma
Synonyms: 2900055E17Rik, E430001K23Rik, Dagk3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110197
HGNC: HGNC:2853
Homologene: 1029
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Il23r
Name: interleukin 23 receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209590
Homologene: 16930
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Birc1f, Naip-rs4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Ptgfr
Name: prostaglandin F receptor
Synonyms: PGF, FP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19220
HGNC: HGNC:9600
Homologene: 741
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: Spacrcan, PG10.2, IPM200
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Slc1a4
Name: solute carrier family 1 (glutamate/neutral amino acid transporter), member 4
Synonyms: ASCT1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55963
Homologene: 20655
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Ikzf4
Name: IKAROS family zinc finger 4
Synonyms: Zfpn1a4, Eos, A630026H08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22781
Homologene: 69103
Bbof1
Name: basal body orientation factor 1
Synonyms: Ccdc176, 2900006K08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72873
Homologene: 75215
Cyp27a1
Name: cytochrome P450, family 27, subfamily a, polypeptide 1
Synonyms: 1300013A03Rik, Cyp27, cholesterol 27 hydroxylase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 104086
HGNC: HGNC:2605
Homologene: 36040
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432486
Homologene: 32576
Axl
Name: AXL receptor tyrosine kinase
Synonyms: Tyro7, Ark, Ufo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26362
HGNC: HGNC:905
Homologene: 7583
Chil3
Name: chitinase-like 3
Synonyms: Chi3l3, Ym1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12655
Homologene: 74931
Zfp955a
Name: zinc finger protein 955A
Synonyms: AI842447
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77652
VEGA: 17
Homologene: 104925
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: Fam71e2, 4930401F20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Asb2
Name: ankyrin repeat and SOCS box-containing 2
Synonyms: 1110008E15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 65256
Homologene: 69202
Rasip1
Name: Ras interacting protein 1
Synonyms: 2610025P08Rik, Rain
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69903
Homologene: 9847
Gm3486
Name: predicted gene 3486
Type: Gene
Species: Mouse
Chromosome: 14
Pga5
Name: pepsinogen 5, group I
Synonyms: 1110035E17Rik, pepsinogen A5, Pepf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58803
VEGA: 19
Homologene: 105932
Slc28a2
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 2
Synonyms: CNT2, 2010208B10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269346
Homologene: 20891
Tcn2
Name: transcobalamin 2
Synonyms: Tcn-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21452
Homologene: 303
Or1e17
Name: olfactory receptor family 1 subfamily E member 17
Synonyms: MTPCR50, MOR135-27, GA_x6K02T2P1NL-4097159-4098136, Olfr23
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18321
Homologene: 115483
Vmn2r112
Name: vomeronasal 2, receptor 112
Synonyms: EG628185
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 628185
Homologene: 86604
Kiz
Name: kizuna centrosomal protein
Synonyms: Plk1s1, Gm114, Ncrna00153, LOC228730
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228730
Homologene: 10219
Adarb2
Name: adenosine deaminase, RNA-specific, B2
Synonyms: RED2, Adar3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94191
HGNC: HGNC:227
Homologene: 10276
Rbbp8nl
Name: RBBP8 N-terminal like
Synonyms: BC066135
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271887
Homologene: 76811
Or8b8
Name: olfactory receptor family 8 subfamily B member 8
Synonyms: MOR161-6, K21, Olfr145, GA_x6K02T2PVTD-31578734-31579666
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258310
HGNC: HGNC:8477
Homologene: 56568
Hyou1
Name: hypoxia up-regulated 1
Synonyms: Grp170, 140 kDa, Orp150, CBP-140, Cab140
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12282
Homologene: 4658
Or8c16
Name: olfactory receptor family 8 subfamily C member 16
Synonyms: Olfr894, GA_x6K02T2PVTD-31898993-31899934, MOR170-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258868
Slc36a4
Name: solute carrier family 36 (proton/amino acid symporter), member 4
Synonyms: 6330573I15Rik, PAT4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234967
Homologene: 56300
Vps16
Name: VSP16 CORVET/HOPS core subunit
Synonyms: 1810074M16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80743
Homologene: 7116
Tktl2
Name: transketolase-like 2
Synonyms: 4933401I19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74419
Homologene: 69456
Tpp1
Name: tripeptidyl peptidase I
Synonyms: Cln2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12751
HGNC: HGNC:2073
Homologene: 335
Or6c75
Name: olfactory receptor family 6 subfamily C member 75
Synonyms: MOR112-1, GA_x6K02T2PULF-11179777-11180721, Olfr790
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258935
Homologene: 74101
Dok6
Name: docking protein 6
Synonyms: Dok-6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 623279
Homologene: 45143
H2-Q4
Name: histocompatibility 2, Q region locus 4
Synonyms: Qa4, Qa-4, Qb1, Qb-1, Qat-4, H-2Q4, H2-Gs10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15015
Homologene: 128352
Qpctl
Name: glutaminyl-peptide cyclotransferase-like
Synonyms: 1810019P04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67369
Homologene: 9765
Crisp2
Name: cysteine-rich secretory protein 2
Synonyms: Tpx1, CRISP-2, GAPDL5, Tpx-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22024
Homologene: 37756
Gm32742
Name: predicted gene, 32742
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102635385
Homologene: 132734
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 44,091,593 bp (GRCm38)
  • C to T, chromosome 1 at 74,713,761 bp (GRCm38)
  • A to G, chromosome 1 at 86,099,572 bp (GRCm38)
  • T to C, chromosome 1 at 188,972,580 bp (GRCm38)
  • T to C, chromosome 2 at 40,858,426 bp (GRCm38)
  • T to C, chromosome 2 at 122,451,041 bp (GRCm38)
  • T to C, chromosome 2 at 130,441,903 bp (GRCm38)
  • T to C, chromosome 2 at 146,953,007 bp (GRCm38)
  • A to G, chromosome 2 at 158,000,772 bp (GRCm38)
  • G to A, chromosome 2 at 164,900,322 bp (GRCm38)
  • A to G, chromosome 2 at 180,279,260 bp (GRCm38)
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp (GRCm38)
  • A to T, chromosome 3 at 106,160,471 bp (GRCm38)
  • A to T, chromosome 3 at 151,835,523 bp (GRCm38)
  • A to G, chromosome 3 at 158,012,199 bp (GRCm38)
  • CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC to CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC, chromosome 4 at 43,177,312 bp (GRCm38)
  • GAGCCA to GAGCCATAGCCA, chromosome 4 at 43,177,313 bp (GRCm38)
  • A to T, chromosome 4 at 129,317,705 bp (GRCm38)
  • G to T, chromosome 5 at 90,961,313 bp (GRCm38)
  • T to G, chromosome 5 at 137,436,483 bp (GRCm38)
  • T to A, chromosome 6 at 47,502,492 bp (GRCm38)
  • A to C, chromosome 6 at 67,426,608 bp (GRCm38)
  • C to T, chromosome 6 at 86,765,793 bp (GRCm38)
  • T to C, chromosome 6 at 149,334,682 bp (GRCm38)
  • T to A, chromosome 7 at 4,758,606 bp (GRCm38)
  • C to T, chromosome 7 at 19,144,674 bp (GRCm38)
  • T to C, chromosome 7 at 25,763,327 bp (GRCm38)
  • G to A, chromosome 7 at 45,628,856 bp (GRCm38)
  • A to T, chromosome 7 at 82,442,448 bp (GRCm38)
  • G to T, chromosome 7 at 105,749,674 bp (GRCm38)
  • C to A, chromosome 7 at 132,270,528 bp (GRCm38)
  • T to C, chromosome 8 at 11,505,504 bp (GRCm38)
  • T to C, chromosome 8 at 22,660,428 bp (GRCm38)
  • A to T, chromosome 8 at 26,011,091 bp (GRCm38)
  • A to T, chromosome 8 at 66,513,322 bp (GRCm38)
  • T to A, chromosome 9 at 15,722,023 bp (GRCm38)
  • A to G, chromosome 9 at 20,929,088 bp (GRCm38)
  • A to G, chromosome 9 at 37,897,416 bp (GRCm38)
  • T to G, chromosome 9 at 38,219,387 bp (GRCm38)
  • T to C, chromosome 9 at 42,337,851 bp (GRCm38)
  • T to A, chromosome 9 at 44,389,629 bp (GRCm38)
  • T to G, chromosome 9 at 51,141,244 bp (GRCm38)
  • T to A, chromosome 9 at 55,043,883 bp (GRCm38)
  • A to G, chromosome 9 at 110,206,152 bp (GRCm38)
  • T to A, chromosome 9 at 110,627,848 bp (GRCm38)
  • G to A, chromosome 9 at 119,972,931 bp (GRCm38)
  • G to A, chromosome 10 at 60,307,527 bp (GRCm38)
  • A to G, chromosome 10 at 88,432,488 bp (GRCm38)
  • T to C, chromosome 10 at 128,636,754 bp (GRCm38)
  • A to T, chromosome 10 at 129,501,495 bp (GRCm38)
  • T to C, chromosome 11 at 3,923,446 bp (GRCm38)
  • G to A, chromosome 11 at 4,160,494 bp (GRCm38)
  • A to G, chromosome 11 at 20,332,025 bp (GRCm38)
  • A to G, chromosome 11 at 73,940,644 bp (GRCm38)
  • A to G, chromosome 11 at 82,796,145 bp (GRCm38)
  • T to C, chromosome 11 at 106,989,466 bp (GRCm38)
  • T to A, chromosome 11 at 116,966,707 bp (GRCm38)
  • A to C, chromosome 12 at 15,815,412 bp (GRCm38)
  • A to G, chromosome 12 at 84,414,620 bp (GRCm38)
  • C to T, chromosome 12 at 103,330,439 bp (GRCm38)
  • T to A, chromosome 13 at 8,757,392 bp (GRCm38)
  • A to G, chromosome 13 at 23,706,136 bp (GRCm38)
  • A to T, chromosome 13 at 30,752,723 bp (GRCm38)
  • C to T, chromosome 13 at 73,973,681 bp (GRCm38)
  • G to T, chromosome 13 at 100,301,385 bp (GRCm38)
  • A to G, chromosome 13 at 100,803,872 bp (GRCm38)
  • G to T, chromosome 14 at 31,316,663 bp (GRCm38)
  • T to C, chromosome 14 at 41,486,361 bp (GRCm38)
  • T to C, chromosome 15 at 76,891,474 bp (GRCm38)
  • T to A, chromosome 15 at 83,306,926 bp (GRCm38)
  • T to C, chromosome 16 at 22,579,831 bp (GRCm38)
  • T to C, chromosome 16 at 37,041,890 bp (GRCm38)
  • A to T, chromosome 16 at 56,252,107 bp (GRCm38)
  • A to T, chromosome 17 at 20,965,237 bp (GRCm38)
  • A to G, chromosome 17 at 22,603,498 bp (GRCm38)
  • T to C, chromosome 17 at 33,242,361 bp (GRCm38)
  • T to G, chromosome 17 at 35,382,933 bp (GRCm38)
  • T to A, chromosome 17 at 40,767,309 bp (GRCm38)
  • T to G, chromosome 17 at 46,410,358 bp (GRCm38)
  • A to G, chromosome 17 at 58,092,468 bp (GRCm38)
  • A to G, chromosome 17 at 73,161,942 bp (GRCm38)
  • G to A, chromosome 17 at 74,658,352 bp (GRCm38)
  • C to T, chromosome 18 at 4,349,170 bp (GRCm38)
  • A to G, chromosome 18 at 21,076,374 bp (GRCm38)
  • G to A, chromosome 18 at 32,080,160 bp (GRCm38)
  • A to G, chromosome 18 at 57,389,245 bp (GRCm38)
  • C to A, chromosome 18 at 65,306,712 bp (GRCm38)
  • T to C, chromosome 18 at 89,474,009 bp (GRCm38)
  • C to T, chromosome 19 at 10,669,533 bp (GRCm38)
  • A to G, chromosome 19 at 44,943,518 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9352 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069162-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.