Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9361Btlr/Mmmh
Stock Number:
069170-MU
Citation ID:
RRID:MMRRC_069170-MU
Other Names:
R9361 (G1)
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Dennd2b
Name: DENN domain containing 2B
Synonyms: 2610305K15Rik, 2010004M01Rik, St5, Denn2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76954
Homologene: 3951
Clmb
Name: calcimembrin
Synonyms: 1190005I06Rik, Mict1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68918
Homologene: 18858
Aasdh
Name: aminoadipate-semialdehyde dehydrogenase
Synonyms: A230062G08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231326
Homologene: 71711
Washc2
Name: WASH complex subunit 2
Synonyms: C530005J20Rik, D6Wsu116e, Fam21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Lrch4
Name: leucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms: 2900069C24Rik, LRRN4, LRN, 2810008P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231798
HGNC: HGNC:6691
Homologene: 20532
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 2 at 23,191,051 bp (GRCm38)
  • T to C, chromosome 2 at 120,014,771 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • A to C, chromosome 3 at 84,448,833 bp (GRCm38)
  • C to A, chromosome 3 at 103,575,363 bp (GRCm38)
  • T to A, chromosome 4 at 43,369,658 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • G to T, chromosome 4 at 85,049,914 bp (GRCm38)
  • T to C, chromosome 4 at 112,143,824 bp (GRCm38)
  • A to C, chromosome 4 at 118,479,632 bp (GRCm38)
  • A to T, chromosome 4 at 126,585,861 bp (GRCm38)
  • G to T, chromosome 4 at 133,486,150 bp (GRCm38)
  • A to T, chromosome 4 at 145,701,429 bp (GRCm38)
  • C to T, chromosome 5 at 11,920,679 bp (GRCm38)
  • A to T, chromosome 5 at 44,055,887 bp (GRCm38)
  • A to T, chromosome 5 at 65,418,543 bp (GRCm38)
  • T to A, chromosome 5 at 76,882,378 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • T to G, chromosome 5 at 96,776,698 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • G to A, chromosome 5 at 137,636,814 bp (GRCm38)
  • T to C, chromosome 6 at 68,755,106 bp (GRCm38)
  • T to C, chromosome 6 at 116,262,472 bp (GRCm38)
  • T to C, chromosome 6 at 136,737,431 bp (GRCm38)
  • T to G, chromosome 6 at 149,326,634 bp (GRCm38)
  • T to C, chromosome 7 at 12,890,437 bp (GRCm38)
  • T to C, chromosome 7 at 27,352,067 bp (GRCm38)
  • G to T, chromosome 7 at 87,003,614 bp (GRCm38)
  • A to G, chromosome 7 at 109,527,784 bp (GRCm38)
  • A to G, chromosome 7 at 127,907,343 bp (GRCm38)
  • T to C, chromosome 8 at 24,589,585 bp (GRCm38)
  • A to T, chromosome 8 at 93,335,018 bp (GRCm38)
  • G to A, chromosome 8 at 104,837,407 bp (GRCm38)
  • C to T, chromosome 8 at 120,634,321 bp (GRCm38)
  • C to T, chromosome 9 at 14,593,381 bp (GRCm38)
  • T to C, chromosome 9 at 56,896,593 bp (GRCm38)
  • C to T, chromosome 9 at 58,117,625 bp (GRCm38)
  • T to C, chromosome 9 at 76,492,794 bp (GRCm38)
  • T to A, chromosome 9 at 89,730,130 bp (GRCm38)
  • T to A, chromosome 9 at 99,459,722 bp (GRCm38)
  • T to A, chromosome 9 at 107,928,625 bp (GRCm38)
  • T to A, chromosome 9 at 108,849,322 bp (GRCm38)
  • T to A, chromosome 9 at 122,861,822 bp (GRCm38)
  • C to A, chromosome 10 at 23,109,867 bp (GRCm38)
  • A to G, chromosome 11 at 49,564,476 bp (GRCm38)
  • A to T, chromosome 11 at 62,146,318 bp (GRCm38)
  • T to G, chromosome 11 at 70,350,853 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • C to T, chromosome 11 at 105,005,698 bp (GRCm38)
  • G to T, chromosome 12 at 4,209,366 bp (GRCm38)
  • A to G, chromosome 12 at 28,746,418 bp (GRCm38)
  • T to A, chromosome 12 at 114,513,365 bp (GRCm38)
  • T to G, chromosome 13 at 9,149,901 bp (GRCm38)
  • T to A, chromosome 13 at 54,590,307 bp (GRCm38)
  • T to C, chromosome 13 at 73,974,618 bp (GRCm38)
  • T to A, chromosome 14 at 6,218,262 bp (GRCm38)
  • T to C, chromosome 14 at 52,770,149 bp (GRCm38)
  • T to G, chromosome 14 at 70,164,741 bp (GRCm38)
  • A to G, chromosome 15 at 66,685,397 bp (GRCm38)
  • C to T, chromosome 15 at 103,439,639 bp (GRCm38)
  • C to T, chromosome 16 at 18,080,970 bp (GRCm38)
  • C to T, chromosome 16 at 94,138,940 bp (GRCm38)
  • A to T, chromosome 17 at 70,761,264 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9361 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069170-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.