Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9361Btlr/Mmmh
Stock Number:
069170-MU
Citation ID:
RRID:MMRRC_069170-MU
Other Names:
R9361 (G1)
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Dennd2b
Name: DENN domain containing 2B
Synonyms: 2610305K15Rik, 2010004M01Rik, St5, Denn2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76954
Homologene: 3951
1190005I06Rik
Name: RIKEN cDNA 1190005I06 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68918
Homologene: 18858
Aasdh
Name: aminoadipate-semialdehyde dehydrogenase
Synonyms: A230062G08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231326
Homologene: 71711
Washc2
Name: WASH complex subunit 2
Synonyms: C530005J20Rik, D6Wsu116e, Fam21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Lrch4
Name: leucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms: 2900069C24Rik, LRRN4, LRN, 2810008P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231798
HGNC: HGNC:6691
Homologene: 20532
Larp4b
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5, A130023E24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217980
Homologene: 18195
Trappc12
Name: trafficking protein particle complex 12
Synonyms: CGI-87, D930014A20Rik, Ttc15
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217449
VEGA: 12
Homologene: 34805
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Gucy2c
Name: guanylate cyclase 2c
Synonyms: GC-C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14917
HGNC: HGNC:4688
Homologene: 3641
Zfp980
Name: zinc finger protein 980
Synonyms: Gm13242
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041379
Homologene: 133076
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Zdhhc11
Name: zinc finger, DHHC domain containing 11
Synonyms: 4933421L13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71164
VEGA: 13
Homologene: 128723
Fhdc1
Name: FH2 domain containing 1
Synonyms: 6330505N24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229474
Homologene: 18920
Alox15
Name: arachidonate 15-lipoxygenase
Synonyms: 12-LO, L-12LO, Alox12l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11687
HGNC: HGNC:433
Homologene: 44935
Clspn
Name: claspin
Synonyms: E130314M08Rik, C85083
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269582
Homologene: 11138
Adcy3
Name: adenylate cyclase 3
Synonyms: AC3, ACIII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104111
HGNC: HGNC:234
Homologene: 2978
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Ankrd34c
Name: ankyrin repeat domain 34C
Synonyms: LOC330998, B230218L05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330998
Homologene: 19814
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Specc1
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: 2810012G08Rik, B230396K10Rik, Cytsb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432572
Homologene: 45157
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, D430008P04Rik, tie-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21846
Homologene: 3957
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: NG2, AN2, 4732461B14Rik, Cspg4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Shkbp1
Name: Sh3kbp1 binding protein 1
Synonyms: SB1, B930062H15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 192192
Homologene: 26700
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Fam83b
Name: family with sequence similarity 83, member B
Synonyms: C530008M07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208994
Homologene: 19478
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: Jnkbp1, 2810483F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Atp8b5
Name: ATPase, class I, type 8B, member 5
Synonyms: FetA, 4930417M19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320571
Homologene: 99882
Prodh
Name: proline dehydrogenase
Synonyms: Pro1, Pro-1, Ym24d07
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19125
HGNC: HGNC:9453
Homologene: 40764
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67722
Homologene: 69412
Or2y10
Name: olfactory receptor family 2 subfamily Y member 10
Synonyms: GA_x6K02T2QP88-5871967-5871032, MOR256-66_i, Olfr1380
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 404336
Homologene: 72463
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Ccdc33
Name: coiled-coil domain containing 33
Synonyms: LOC382077, 4930535E21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382077
Homologene: 19641
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: 4732473B16Rik, Fam46b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100342
Homologene: 24928
Ces1g
Name: carboxylesterase 1G
Synonyms: Ces-1, Ses-1, Ces1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12623
Homologene: 137354
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Eya4
Name: EYA transcriptional coactivator and phosphatase 4
Synonyms: B130023L16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14051
VEGA: 10
HGNC: HGNC:3522
Homologene: 3025
Dlgap1
Name: DLG associated protein 1
Synonyms: SAPAP1, DAP-1 beta, D17Bwg0511e, GKAP/SAPAP, Sapap1, 4933422O14Rik, Gkap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Skint4
Name: selection and upkeep of intraepithelial T cells 4
Synonyms: 9530098N22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320640
Gtsf2
Name: gametocyte specific factor 2
Synonyms: BC048502
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223927
VEGA: 15
Homologene: 77620
Ido1
Name: indoleamine 2,3-dioxygenase 1
Synonyms: Ido, Indo
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15930
HGNC: HGNC:6059
Homologene: 48082
Pdlim2
Name: PDZ and LIM domain 2
Synonyms: mystique, SLIM, 4732462F18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213019
Homologene: 11006
Zfp128
Name: zinc finger protein 128
Synonyms: mZnf8, 9630016P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243833
Homologene: 10889
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Ugdh
Name: UDP-glucose dehydrogenase
Synonyms: Udpgdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22235
Homologene: 2520
Bckdk
Name: branched chain ketoacid dehydrogenase kinase
Synonyms: BCKD-kinase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12041
Homologene: 37642
Pramel39-ps
Name: PRAME like 39, pseudogene
Synonyms: Gm16522, A430089I19Rik, Pramel39
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 331195
Homologene: 77633
Higd2a
Name: HIG1 domain family, member 2A
Synonyms: 2010110M21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67044
Homologene: 32648
Nme9
Name: NME/NM23 family member 9
Synonyms: Txndc6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 623534
Homologene: 52255
Igkv4-92
Name: immunoglobulin kappa variable 4-92
Synonyms: LOC384410, IgVk ay4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384410
Speer1m
Name: spermatogenesis associated glutamate (E)-rich protein 1M
Synonyms: 4933402N22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545732
Homologene: 69402
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 2 at 23,191,051 bp (GRCm38)
  • T to C, chromosome 2 at 120,014,771 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • A to C, chromosome 3 at 84,448,833 bp (GRCm38)
  • C to A, chromosome 3 at 103,575,363 bp (GRCm38)
  • T to A, chromosome 4 at 43,369,658 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • G to T, chromosome 4 at 85,049,914 bp (GRCm38)
  • T to C, chromosome 4 at 112,143,824 bp (GRCm38)
  • A to C, chromosome 4 at 118,479,632 bp (GRCm38)
  • A to T, chromosome 4 at 126,585,861 bp (GRCm38)
  • G to T, chromosome 4 at 133,486,150 bp (GRCm38)
  • A to T, chromosome 4 at 145,701,429 bp (GRCm38)
  • C to T, chromosome 5 at 11,920,679 bp (GRCm38)
  • A to T, chromosome 5 at 44,055,887 bp (GRCm38)
  • A to T, chromosome 5 at 65,418,543 bp (GRCm38)
  • T to A, chromosome 5 at 76,882,378 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • T to G, chromosome 5 at 96,776,698 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • G to A, chromosome 5 at 137,636,814 bp (GRCm38)
  • T to C, chromosome 6 at 68,755,106 bp (GRCm38)
  • T to C, chromosome 6 at 116,262,472 bp (GRCm38)
  • T to C, chromosome 6 at 136,737,431 bp (GRCm38)
  • T to G, chromosome 6 at 149,326,634 bp (GRCm38)
  • T to C, chromosome 7 at 12,890,437 bp (GRCm38)
  • T to C, chromosome 7 at 27,352,067 bp (GRCm38)
  • G to T, chromosome 7 at 87,003,614 bp (GRCm38)
  • A to G, chromosome 7 at 109,527,784 bp (GRCm38)
  • A to G, chromosome 7 at 127,907,343 bp (GRCm38)
  • T to C, chromosome 8 at 24,589,585 bp (GRCm38)
  • A to T, chromosome 8 at 93,335,018 bp (GRCm38)
  • G to A, chromosome 8 at 104,837,407 bp (GRCm38)
  • C to T, chromosome 8 at 120,634,321 bp (GRCm38)
  • C to T, chromosome 9 at 14,593,381 bp (GRCm38)
  • T to C, chromosome 9 at 56,896,593 bp (GRCm38)
  • C to T, chromosome 9 at 58,117,625 bp (GRCm38)
  • T to C, chromosome 9 at 76,492,794 bp (GRCm38)
  • T to A, chromosome 9 at 89,730,130 bp (GRCm38)
  • T to A, chromosome 9 at 99,459,722 bp (GRCm38)
  • T to A, chromosome 9 at 107,928,625 bp (GRCm38)
  • T to A, chromosome 9 at 108,849,322 bp (GRCm38)
  • T to A, chromosome 9 at 122,861,822 bp (GRCm38)
  • C to A, chromosome 10 at 23,109,867 bp (GRCm38)
  • A to G, chromosome 11 at 49,564,476 bp (GRCm38)
  • A to T, chromosome 11 at 62,146,318 bp (GRCm38)
  • T to G, chromosome 11 at 70,350,853 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • C to T, chromosome 11 at 105,005,698 bp (GRCm38)
  • G to T, chromosome 12 at 4,209,366 bp (GRCm38)
  • A to G, chromosome 12 at 28,746,418 bp (GRCm38)
  • T to A, chromosome 12 at 114,513,365 bp (GRCm38)
  • T to G, chromosome 13 at 9,149,901 bp (GRCm38)
  • T to A, chromosome 13 at 54,590,307 bp (GRCm38)
  • T to C, chromosome 13 at 73,974,618 bp (GRCm38)
  • T to A, chromosome 14 at 6,218,262 bp (GRCm38)
  • T to C, chromosome 14 at 52,770,149 bp (GRCm38)
  • T to G, chromosome 14 at 70,164,741 bp (GRCm38)
  • A to G, chromosome 15 at 66,685,397 bp (GRCm38)
  • C to T, chromosome 15 at 103,439,639 bp (GRCm38)
  • C to T, chromosome 16 at 18,080,970 bp (GRCm38)
  • C to T, chromosome 16 at 94,138,940 bp (GRCm38)
  • A to T, chromosome 17 at 70,761,264 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9361 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069170-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.