Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9378Btlr/Mmmh
Stock Number:
069186-MU
Citation ID:
RRID:MMRRC_069186-MU
Other Names:
R9378 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Ighm
Name: immunoglobulin heavy constant mu
Synonyms: Ig mu, Igh6, Igh-M, muH, IgM, TC1460681
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Lpp
Name: LIM domain containing preferred translocation partner in lipoma
Synonyms: B130055L10Rik, 9430020K16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 210126
VEGA: 16
HGNC: HGNC:6679
Homologene: 4075
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9030421L11Rik, 9130004I02Rik, 9430095K15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Hsp90ab1
Name: heat shock protein 90 alpha (cytosolic), class B member 1
Synonyms: Hsp84, Hsp90, Hsp84-1, C81438, Hspcb
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15516
Homologene: 74306
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 17,157,129 bp (GRCm38)
  • A to T, chromosome 1 at 53,582,617 bp (GRCm38)
  • A to T, chromosome 1 at 86,262,044 bp (GRCm38)
  • A to G, chromosome 1 at 87,957,310 bp (GRCm38)
  • T to A, chromosome 2 at 25,439,082 bp (GRCm38)
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp (GRCm38)
  • C to A, chromosome 2 at 52,244,101 bp (GRCm38)
  • A to C, chromosome 2 at 52,247,292 bp (GRCm38)
  • C to A, chromosome 2 at 87,711,079 bp (GRCm38)
  • T to C, chromosome 2 at 89,157,055 bp (GRCm38)
  • G to A, chromosome 2 at 119,812,167 bp (GRCm38)
  • A to T, chromosome 2 at 142,619,818 bp (GRCm38)
  • A to T, chromosome 2 at 164,110,216 bp (GRCm38)
  • A to T, chromosome 3 at 18,096,673 bp (GRCm38)
  • A to T, chromosome 3 at 53,651,989 bp (GRCm38)
  • A to G, chromosome 3 at 59,931,689 bp (GRCm38)
  • G to A, chromosome 3 at 131,342,362 bp (GRCm38)
  • T to A, chromosome 4 at 3,595,475 bp (GRCm38)
  • T to C, chromosome 4 at 6,440,940 bp (GRCm38)
  • T to A, chromosome 4 at 19,922,377 bp (GRCm38)
  • T to A, chromosome 4 at 43,173,282 bp (GRCm38)
  • T to A, chromosome 4 at 49,325,627 bp (GRCm38)
  • T to A, chromosome 4 at 55,011,510 bp (GRCm38)
  • T to A, chromosome 4 at 62,388,606 bp (GRCm38)
  • T to C, chromosome 4 at 63,431,842 bp (GRCm38)
  • T to G, chromosome 4 at 90,224,338 bp (GRCm38)
  • G to A, chromosome 5 at 14,765,863 bp (GRCm38)
  • T to C, chromosome 5 at 21,585,203 bp (GRCm38)
  • A to T, chromosome 5 at 89,700,410 bp (GRCm38)
  • A to G, chromosome 5 at 109,427,866 bp (GRCm38)
  • A to T, chromosome 5 at 147,024,370 bp (GRCm38)
  • A to T, chromosome 6 at 72,385,571 bp (GRCm38)
  • T to A, chromosome 6 at 73,212,530 bp (GRCm38)
  • A to G, chromosome 6 at 87,433,702 bp (GRCm38)
  • T to G, chromosome 6 at 101,150,811 bp (GRCm38)
  • A to T, chromosome 7 at 11,066,265 bp (GRCm38)
  • A to T, chromosome 7 at 25,340,415 bp (GRCm38)
  • C to A, chromosome 7 at 26,840,454 bp (GRCm38)
  • C to T, chromosome 7 at 81,332,871 bp (GRCm38)
  • A to T, chromosome 7 at 103,670,182 bp (GRCm38)
  • G to A, chromosome 7 at 118,178,775 bp (GRCm38)
  • A to T, chromosome 7 at 120,207,968 bp (GRCm38)
  • A to G, chromosome 8 at 22,775,583 bp (GRCm38)
  • C to T, chromosome 8 at 61,516,657 bp (GRCm38)
  • C to A, chromosome 8 at 66,704,209 bp (GRCm38)
  • T to A, chromosome 8 at 93,186,096 bp (GRCm38)
  • A to G, chromosome 9 at 37,712,177 bp (GRCm38)
  • G to A, chromosome 9 at 38,047,479 bp (GRCm38)
  • G to A, chromosome 9 at 44,704,128 bp (GRCm38)
  • A to T, chromosome 9 at 57,420,288 bp (GRCm38)
  • G to A, chromosome 9 at 108,107,655 bp (GRCm38)
  • C to T, chromosome 9 at 108,958,640 bp (GRCm38)
  • A to T, chromosome 9 at 121,748,198 bp (GRCm38)
  • T to G, chromosome 10 at 5,250,954 bp (GRCm38)
  • C to T, chromosome 10 at 44,440,154 bp (GRCm38)
  • A to G, chromosome 10 at 125,997,084 bp (GRCm38)
  • A to T, chromosome 11 at 53,372,479 bp (GRCm38)
  • A to C, chromosome 11 at 67,202,433 bp (GRCm38)
  • A to T, chromosome 11 at 107,173,679 bp (GRCm38)
  • A to G, chromosome 11 at 119,208,840 bp (GRCm38)
  • T to C, chromosome 12 at 21,308,038 bp (GRCm38)
  • C to T, chromosome 12 at 24,655,044 bp (GRCm38)
  • A to G, chromosome 12 at 37,243,721 bp (GRCm38)
  • T to C, chromosome 12 at 72,555,890 bp (GRCm38)
  • G to A, chromosome 12 at 84,791,090 bp (GRCm38)
  • T to A, chromosome 12 at 113,422,590 bp (GRCm38)
  • A to G, chromosome 13 at 77,323,616 bp (GRCm38)
  • A to G, chromosome 13 at 113,056,097 bp (GRCm38)
  • G to A, chromosome 14 at 26,927,827 bp (GRCm38)
  • A to G, chromosome 15 at 79,828,405 bp (GRCm38)
  • A to G, chromosome 15 at 82,761,601 bp (GRCm38)
  • A to T, chromosome 15 at 85,777,636 bp (GRCm38)
  • G to A, chromosome 15 at 94,585,455 bp (GRCm38)
  • A to G, chromosome 15 at 98,227,039 bp (GRCm38)
  • A to C, chromosome 15 at 102,227,396 bp (GRCm38)
  • T to C, chromosome 16 at 20,214,478 bp (GRCm38)
  • A to T, chromosome 16 at 24,721,987 bp (GRCm38)
  • A to G, chromosome 16 at 38,526,771 bp (GRCm38)
  • T to C, chromosome 16 at 59,461,674 bp (GRCm38)
  • T to A, chromosome 16 at 96,176,012 bp (GRCm38)
  • G to A, chromosome 17 at 38,082,165 bp (GRCm38)
  • T to C, chromosome 17 at 45,570,754 bp (GRCm38)
  • C to A, chromosome 17 at 80,061,862 bp (GRCm38)
  • T to C, chromosome 17 at 80,453,810 bp (GRCm38)
  • A to T, chromosome 18 at 32,419,868 bp (GRCm38)
  • A to G, chromosome 18 at 36,947,231 bp (GRCm38)
  • T to C, chromosome 18 at 80,129,422 bp (GRCm38)
  • A to G, chromosome 19 at 41,038,917 bp (GRCm38)
  • TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG to TCCAGG, chromosome X at 53,774,554 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9378 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069186-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.