Strain Name:
C57BL/6J-MtgxR9378Btlr/Mmmh
Stock Number:
069186-MU
Citation ID:
RRID:MMRRC_069186-MU
Other Names:
R9378 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Ighm
Name: immunoglobulin heavy constant mu
Synonyms: IgM, muH, Igh-M, Ig mu, Igh6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Npyr, Y1-R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: my, b2b1562Clo, 6030440P17Rik, ne, 8430406N05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Lpp
Name: LIM domain containing preferred translocation partner in lipoma
Synonyms: 9430020K16Rik, B130055L10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 210126
VEGA: 16
HGNC: HGNC:6679
Homologene: 4075
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9430095K15Rik, 9030421L11Rik, 9130004I02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Hsp90ab1
Name: heat shock protein 90 alpha (cytosolic), class B member 1
Synonyms: Hspcb, Hsp90, C81438, Hsp84, Hsp84-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15516
Homologene: 74306
Ppcdc
Name: phosphopantothenoylcysteine decarboxylase
Synonyms: 1810057I13Rik, 8430432M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66812
VEGA: 9
Homologene: 11049
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Armc9
Name: armadillo repeat containing 9
Synonyms: 5730415N24Rik, 4831423D23Rik, 3830422A13Rik, 4930438O05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78795
Homologene: 11847
Stk4
Name: serine/threonine kinase 4
Synonyms: Kas-2, sterile 20-like kinase 1, Ysk3, Mst1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58231
Homologene: 55965
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: Hnrpll, 2810036L13Rik, 2510028H02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Zfp462
Name: zinc finger protein 462
Synonyms: 9430078C22Rik, Zfpip, Gt4-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: 5430435M13Rik, C130002K18Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Aff4
Name: AF4/FMR2 family, member 4
Synonyms: Laf4l, Alf4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93736
Homologene: 8683
Phldb1
Name: pleckstrin homology like domain, family B, member 1
Synonyms: D330037A14Rik, LL5A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102693
Homologene: 15903
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: SYNE-1, A330049M09Rik, enaptin165, nesprin-1, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Sos1
Name: SOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms: 4430401P03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20662
VEGA: 17
Homologene: 4117
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Gabrr3
Name: gamma-aminobutyric acid type A receptor subunit rho 3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328699
VEGA: 16
Homologene: 26716
Twf1
Name: twinfilin actin binding protein 1
Synonyms: Twinfilin-1, actin monomer-binding protein, twinfilin, Ptk9, A6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19230
HGNC: HGNC:9620
Homologene: 48140
Adnp2
Name: ADNP homeobox 2
Synonyms: Zfp508, 8430420L05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240442
Homologene: 8945
Plppr1
Name: phospholipid phosphatase related 1
Synonyms: E130309F12Rik, Lppr1, PRG-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 272031
Homologene: 9815
Nktr
Name: natural killer tumor recognition sequence
Synonyms: 5330401F18Rik, D9Wsu172e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Cpsf3
Name: cleavage and polyadenylation specificity factor 3
Synonyms: 73 kDa
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54451
VEGA: 12
HGNC: HGNC:2326
Homologene: 6499
Nol11
Name: nucleolar protein 11
Synonyms: 1500002M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68979
Homologene: 32264
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72333
Homologene: 75052
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 2900057D21Rik, 7330406P05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Cyp7b1
Name: cytochrome P450, family 7, subfamily b, polypeptide 1
Synonyms: hct-1, D3Ertd552e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13123
HGNC: HGNC:2652
Homologene: 3544
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Ppara
Name: peroxisome proliferator activated receptor alpha
Synonyms: Nr1c1, PPARalpha, 4933429D07Rik, PPAR-alpha, Ppar
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19013
HGNC: HGNC:9232
Homologene: 21047
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Pcnx4
Name: pecanex homolog 4
Synonyms: 1810048J11Rik, Pcnxl4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Prdm1
Name: PR domain containing 1, with ZNF domain
Synonyms: Blimp-1, PRDI-BF1, Blimp1, b2b1765Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12142
HGNC: HGNC:9346
Homologene: 925
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Or8b37
Name: olfactory receptor family 8 subfamily B member 37
Synonyms: MOR162-11P, MOR162-13, MOR162-11P, Olfr1550-ps1, MOR162-9P, GA_x6K02T2PVTD-31726544-31727473, Olfr884
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257996
Homologene: 79400
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320118
Homologene: 27057
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: Myhs-f2, IId/x, IId, A530084A17Rik, MyHC-IId/x, Myhsf2, myosin heavy chain 2X, MYHC-IIX, Myhs-f
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
Lnx2
Name: ligand of numb-protein X 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140887
Homologene: 17737
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Cyp2d40
Name: cytochrome P450, family 2, subfamily d, polypeptide 40
Synonyms: 1300013D18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71754
VEGA: 15
Homologene: 135470
Megf8
Name: multiple EGF-like-domains 8
Synonyms: m687Ddg, b2b288Clo, b2b1702Clo, Egfl4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Tyro3
Name: TYRO3 protein tyrosine kinase 3
Synonyms: Dtk, Rse, Sky, Tif, Etk-2, Sky, Brt
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22174
Homologene: 4585
Atp6v0d2
Name: ATPase, H+ transporting, lysosomal V0 subunit D2
Synonyms: 1620401A02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242341
Homologene: 72090
Itgb7
Name: integrin beta 7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16421
HGNC: HGNC:6162
Homologene: 20247
Or4c119
Name: olfactory receptor family 4 subfamily C member 119
Synonyms: MOR233-15, Olfr1224, GA_x6K02T2Q125-50635980-50635046
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258026
Whrn
Name: whirlin
Synonyms: wi, C430046P22Rik, Dfnb31, 1110035G07Rik, Ush2d
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73750
Homologene: 18739
Aadacl2fm1
Name: AADACL2 family member 1
Synonyms: C130079G13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229333
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 4930539G24Rik, 1700110B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: LNX3, Semcap3, semaphorin cytoplasmic domain-associated protein 3A, 1110020C07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Tbc1d16
Name: TBC1 domain family, member 16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207592
Homologene: 10380
Ces1d
Name: carboxylesterase 1D
Synonyms: TGH, Ces3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: Abc2, D2H0S1474E
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
Tgs1
Name: trimethylguanosine synthase 1
Synonyms: Pimt, Ncoa6ip, D4Ertd800e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 116940
Homologene: 32608
Cdc20b
Name: cell division cycle 20B
Synonyms: EG622422, EG238896
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238896
Homologene: 65056
2210408I21Rik
Name: RIKEN cDNA 2210408I21 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72371
Homologene: 89234
Klf11
Name: Kruppel-like transcription factor 11
Synonyms: Tieg3, Tieg2b, D12Ertd427e, Tieg2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 194655
Homologene: 2668
Or51v8
Name: olfactory receptor family 51 subfamily V member 8
Synonyms: Olfr624, GA_x6K02T2PBJ9-6394126-6393197, MOR4-2P
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258189
Homologene: 66460
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
Lca5l
Name: Leber congenital amaurosis 5-like
Synonyms: 4921526F01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385668
HGNC: HGNC:1255
Homologene: 47978
Or5w14
Name: olfactory receptor family 5 subfamily W member 14
Synonyms: Olfr1137, MOR177-20, MOR40-9P, GA_x6K02T2Q125-49215724-49214792
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258101
Homologene: 79380
Slc31a1
Name: solute carrier family 31, member 1
Synonyms: Ctr1, 4930445G01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20529
Homologene: 1399
Cbx6
Name: chromobox 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 494448
HGNC: HGNC:1556
Homologene: 8619
Sgms2
Name: sphingomyelin synthase 2
Synonyms: 4933405A16Rik, 5133401H06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74442
Homologene: 32705
Poglut1
Name: protein O-glucosyltransferase 1
Synonyms: Rumi, 9630046K23Rik, wsnp, Ktelc1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224143
Homologene: 41353
Or2y3
Name: olfactory receptor family 2 subfamily Y member 3
Synonyms: MOR256-4, Olfr131, GA_x6K02T2PSCP-2531299-2530355
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258867
Homologene: 105889
Agmo
Name: alkylglycerol monooxygenase
Synonyms: A530016O06Rik, Tmem195
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319660
Homologene: 45620
Cyp2a5
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13087
Homologene: 85917
Or10ad1b
Name: olfactory receptor family 10 subfamily AD member 1B
Synonyms: EG629524, Olfr286, GA_x6K02T2NBG7-5528233-5529186, MOR286-2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 629524
Homologene: 134078
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Bin1
Name: bridging integrator 1
Synonyms: Amphl, Amphiphysin 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 30948
VEGA: 18
HGNC: HGNC:1052
Homologene: 113707
Gdap1
Name: ganglioside-induced differentiation-associated-protein 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14545
Homologene: 40713
Vamp8
Name: vesicle-associated membrane protein 8
Synonyms: endobrevin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22320
Homologene: 37846
Bmp10
Name: bone morphogenetic protein 10
Synonyms: b2b2711Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12154
Homologene: 7644
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Zfp36l3
Name: zinc finger protein 36, C3H type-like 3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 333473
Or8a1b
Name: olfactory receptor family 8 subfamily A member 1B
Synonyms: MOR171-3, GA_x6K02T2PVTD-31389446-31388517, MOR171-3, M72, Olfr160
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80706
HGNC: HGNC:8469
Homologene: 12726
Zscan4-ps1
Name: zinc finger and SCAN domain containing 4, pseudogene 1
Synonyms: EG545912
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545912
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 17,157,129 bp (GRCm38)
  • A to T, chromosome 1 at 53,582,617 bp (GRCm38)
  • A to T, chromosome 1 at 86,262,044 bp (GRCm38)
  • A to G, chromosome 1 at 87,957,310 bp (GRCm38)
  • T to A, chromosome 2 at 25,439,082 bp (GRCm38)
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp (GRCm38)
  • C to A, chromosome 2 at 52,244,101 bp (GRCm38)
  • A to C, chromosome 2 at 52,247,292 bp (GRCm38)
  • C to A, chromosome 2 at 87,711,079 bp (GRCm38)
  • T to C, chromosome 2 at 89,157,055 bp (GRCm38)
  • G to A, chromosome 2 at 119,812,167 bp (GRCm38)
  • A to T, chromosome 2 at 142,619,818 bp (GRCm38)
  • A to T, chromosome 2 at 164,110,216 bp (GRCm38)
  • A to T, chromosome 3 at 18,096,673 bp (GRCm38)
  • A to T, chromosome 3 at 53,651,989 bp (GRCm38)
  • A to G, chromosome 3 at 59,931,689 bp (GRCm38)
  • G to A, chromosome 3 at 131,342,362 bp (GRCm38)
  • T to A, chromosome 4 at 3,595,475 bp (GRCm38)
  • T to C, chromosome 4 at 6,440,940 bp (GRCm38)
  • T to A, chromosome 4 at 19,922,377 bp (GRCm38)
  • T to A, chromosome 4 at 43,173,282 bp (GRCm38)
  • T to A, chromosome 4 at 49,325,627 bp (GRCm38)
  • T to A, chromosome 4 at 55,011,510 bp (GRCm38)
  • T to A, chromosome 4 at 62,388,606 bp (GRCm38)
  • T to C, chromosome 4 at 63,431,842 bp (GRCm38)
  • T to G, chromosome 4 at 90,224,338 bp (GRCm38)
  • G to A, chromosome 5 at 14,765,863 bp (GRCm38)
  • T to C, chromosome 5 at 21,585,203 bp (GRCm38)
  • A to T, chromosome 5 at 89,700,410 bp (GRCm38)
  • A to G, chromosome 5 at 109,427,866 bp (GRCm38)
  • A to T, chromosome 5 at 147,024,370 bp (GRCm38)
  • A to T, chromosome 6 at 72,385,571 bp (GRCm38)
  • T to A, chromosome 6 at 73,212,530 bp (GRCm38)
  • A to G, chromosome 6 at 87,433,702 bp (GRCm38)
  • T to G, chromosome 6 at 101,150,811 bp (GRCm38)
  • A to T, chromosome 7 at 11,066,265 bp (GRCm38)
  • A to T, chromosome 7 at 25,340,415 bp (GRCm38)
  • C to A, chromosome 7 at 26,840,454 bp (GRCm38)
  • C to T, chromosome 7 at 81,332,871 bp (GRCm38)
  • A to T, chromosome 7 at 103,670,182 bp (GRCm38)
  • G to A, chromosome 7 at 118,178,775 bp (GRCm38)
  • A to T, chromosome 7 at 120,207,968 bp (GRCm38)
  • A to G, chromosome 8 at 22,775,583 bp (GRCm38)
  • C to T, chromosome 8 at 61,516,657 bp (GRCm38)
  • C to A, chromosome 8 at 66,704,209 bp (GRCm38)
  • T to A, chromosome 8 at 93,186,096 bp (GRCm38)
  • A to G, chromosome 9 at 37,712,177 bp (GRCm38)
  • G to A, chromosome 9 at 38,047,479 bp (GRCm38)
  • G to A, chromosome 9 at 44,704,128 bp (GRCm38)
  • A to T, chromosome 9 at 57,420,288 bp (GRCm38)
  • G to A, chromosome 9 at 108,107,655 bp (GRCm38)
  • C to T, chromosome 9 at 108,958,640 bp (GRCm38)
  • A to T, chromosome 9 at 121,748,198 bp (GRCm38)
  • T to G, chromosome 10 at 5,250,954 bp (GRCm38)
  • C to T, chromosome 10 at 44,440,154 bp (GRCm38)
  • A to G, chromosome 10 at 125,997,084 bp (GRCm38)
  • A to T, chromosome 11 at 53,372,479 bp (GRCm38)
  • A to C, chromosome 11 at 67,202,433 bp (GRCm38)
  • A to T, chromosome 11 at 107,173,679 bp (GRCm38)
  • A to G, chromosome 11 at 119,208,840 bp (GRCm38)
  • T to C, chromosome 12 at 21,308,038 bp (GRCm38)
  • C to T, chromosome 12 at 24,655,044 bp (GRCm38)
  • A to G, chromosome 12 at 37,243,721 bp (GRCm38)
  • T to C, chromosome 12 at 72,555,890 bp (GRCm38)
  • G to A, chromosome 12 at 84,791,090 bp (GRCm38)
  • T to A, chromosome 12 at 113,422,590 bp (GRCm38)
  • A to G, chromosome 13 at 77,323,616 bp (GRCm38)
  • A to G, chromosome 13 at 113,056,097 bp (GRCm38)
  • G to A, chromosome 14 at 26,927,827 bp (GRCm38)
  • A to G, chromosome 15 at 79,828,405 bp (GRCm38)
  • A to G, chromosome 15 at 82,761,601 bp (GRCm38)
  • A to T, chromosome 15 at 85,777,636 bp (GRCm38)
  • G to A, chromosome 15 at 94,585,455 bp (GRCm38)
  • A to G, chromosome 15 at 98,227,039 bp (GRCm38)
  • A to C, chromosome 15 at 102,227,396 bp (GRCm38)
  • T to C, chromosome 16 at 20,214,478 bp (GRCm38)
  • A to T, chromosome 16 at 24,721,987 bp (GRCm38)
  • A to G, chromosome 16 at 38,526,771 bp (GRCm38)
  • T to C, chromosome 16 at 59,461,674 bp (GRCm38)
  • T to A, chromosome 16 at 96,176,012 bp (GRCm38)
  • G to A, chromosome 17 at 38,082,165 bp (GRCm38)
  • T to C, chromosome 17 at 45,570,754 bp (GRCm38)
  • C to A, chromosome 17 at 80,061,862 bp (GRCm38)
  • T to C, chromosome 17 at 80,453,810 bp (GRCm38)
  • A to T, chromosome 18 at 32,419,868 bp (GRCm38)
  • A to G, chromosome 18 at 36,947,231 bp (GRCm38)
  • T to C, chromosome 18 at 80,129,422 bp (GRCm38)
  • A to G, chromosome 19 at 41,038,917 bp (GRCm38)
  • TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG to TCCAGG, chromosome X at 53,774,554 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9378 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069186-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.