Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9396Btlr/Mmmh
Stock Number:
069200-MU
Citation ID:
RRID:MMRRC_069200-MU
Other Names:
R9396 (G1)
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Mapt
Name: microtubule-associated protein tau
Synonyms: Mtapt, Tau
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17762
HGNC: HGNC:6893
Homologene: 74962
Csrnp3
Name: cysteine-serine-rich nuclear protein 3
Synonyms: mbu1, A330102K23Rik, CSRNP-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77771
Homologene: 11803
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Sin3a
Name: SIN3 transcription regulator family member A
Synonyms: Sin3, mSin3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20466
Homologene: 32124
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 169,510,348 bp (GRCm38)
  • A to G, chromosome 2 at 25,248,909 bp (GRCm38)
  • G to T, chromosome 2 at 35,037,603 bp (GRCm38)
  • C to T, chromosome 2 at 66,002,497 bp (GRCm38)
  • A to T, chromosome 2 at 86,455,501 bp (GRCm38)
  • A to G, chromosome 2 at 111,489,519 bp (GRCm38)
  • C to T, chromosome 2 at 127,337,718 bp (GRCm38)
  • T to A, chromosome 3 at 96,287,074 bp (GRCm38)
  • A to G, chromosome 4 at 70,254,666 bp (GRCm38)
  • C to T, chromosome 4 at 70,264,658 bp (GRCm38)
  • G to T, chromosome 4 at 135,785,888 bp (GRCm38)
  • T to C, chromosome 5 at 37,319,090 bp (GRCm38)
  • G to A, chromosome 5 at 53,707,281 bp (GRCm38)
  • T to C, chromosome 5 at 99,229,329 bp (GRCm38)
  • A to G, chromosome 5 at 104,310,431 bp (GRCm38)
  • A to G, chromosome 5 at 127,617,399 bp (GRCm38)
  • T to C, chromosome 6 at 146,621,974 bp (GRCm38)
  • T to C, chromosome 7 at 44,591,513 bp (GRCm38)
  • G to A, chromosome 7 at 102,415,385 bp (GRCm38)
  • A to C, chromosome 7 at 102,484,973 bp (GRCm38)
  • A to G, chromosome 7 at 104,040,513 bp (GRCm38)
  • A to G, chromosome 7 at 118,208,080 bp (GRCm38)
  • A to G, chromosome 7 at 133,660,109 bp (GRCm38)
  • A to T, chromosome 7 at 142,370,967 bp (GRCm38)
  • T to C, chromosome 8 at 80,736,729 bp (GRCm38)
  • C to T, chromosome 8 at 105,913,459 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • A to G, chromosome 8 at 123,401,092 bp (GRCm38)
  • A to G, chromosome 9 at 26,975,745 bp (GRCm38)
  • A to G, chromosome 9 at 57,101,161 bp (GRCm38)
  • T to C, chromosome 9 at 87,727,379 bp (GRCm38)
  • T to C, chromosome 9 at 88,567,207 bp (GRCm38)
  • A to C, chromosome 9 at 122,852,516 bp (GRCm38)
  • T to A, chromosome 10 at 18,524,001 bp (GRCm38)
  • A to G, chromosome 10 at 108,264,710 bp (GRCm38)
  • C to A, chromosome 11 at 52,773,951 bp (GRCm38)
  • T to A, chromosome 11 at 74,365,263 bp (GRCm38)
  • A to T, chromosome 11 at 83,422,833 bp (GRCm38)
  • C to A, chromosome 11 at 104,298,729 bp (GRCm38)
  • G to A, chromosome 11 at 114,987,404 bp (GRCm38)
  • A to G, chromosome 11 at 116,075,703 bp (GRCm38)
  • A to G, chromosome 12 at 64,967,655 bp (GRCm38)
  • G to T, chromosome 12 at 78,824,747 bp (GRCm38)
  • T to G, chromosome 13 at 58,013,848 bp (GRCm38)
  • T to A, chromosome 13 at 105,181,519 bp (GRCm38)
  • T to C, chromosome 15 at 77,389,725 bp (GRCm38)
  • T to C, chromosome 15 at 77,763,296 bp (GRCm38)
  • T to C, chromosome 15 at 91,343,712 bp (GRCm38)
  • G to A, chromosome 16 at 59,148,939 bp (GRCm38)
  • T to C, chromosome 16 at 66,747,216 bp (GRCm38)
  • C to T, chromosome 17 at 24,884,502 bp (GRCm38)
  • T to A, chromosome 17 at 38,175,530 bp (GRCm38)
  • T to A, chromosome 17 at 84,692,854 bp (GRCm38)
  • T to A, chromosome 18 at 20,041,716 bp (GRCm38)
  • C to T, chromosome 18 at 62,922,660 bp (GRCm38)
  • A to T, chromosome 19 at 37,934,846 bp (GRCm38)
  • C to T, chromosome X at 99,845,491 bp (GRCm38)
  • A to G, chromosome X at 170,676,406 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9396 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069200-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.