Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9399Btlr/Mmmh
Stock Number:
069203-MU
Citation ID:
RRID:MMRRC_069203-MU
Other Names:
R9399 (G1)
Major Collection:

Strain Information

Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Cdk7
Name: cyclin dependent kinase 7
Synonyms: CRK4 PK (CDC2-related-kinase-4 protein kinase), Crk4, Cdkn7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12572
VEGA: 13
HGNC: HGNC:1778
Homologene: 1363
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Clptm1
Name: cleft lip and palate associated transmembrane protein 1
Synonyms: N14, HS9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56457
HGNC: HGNC:2087
Homologene: 37464
Rufy3
Name: RUN and FYVE domain containing 3
Synonyms: 2810428M05Rik, 6330416M07Rik, D5Bwg0860e, Rpipx
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52822
Homologene: 87809
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212285
Homologene: 9064
Mmp17
Name: matrix metallopeptidase 17
Synonyms: MT4-MMP, membrane type-4 matrix metalloproteinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23948
HGNC: HGNC:7163
Homologene: 22669
Midn
Name: midnolin
Synonyms: 3000003C15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59090
Homologene: 32510
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 59035
Homologene: 10990
Raph1
Name: Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms: C730009O10Rik, 9430025M21Rik, lamellipodin, Lpd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77300
Homologene: 71030
Bcl9
Name: B cell CLL/lymphoma 9
Synonyms: 8030475K17Rik, A330041G23Rik, 2610202E01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77578
HGNC: HGNC:1008
Homologene: 3191
Amotl2
Name: angiomotin-like 2
Synonyms: Lccp, MASCOT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56332
Homologene: 9420
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Fgfr4
Name: fibroblast growth factor receptor 4
Synonyms: Fgfr-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14186
HGNC: HGNC:3691
Homologene: 20461
Ppp1r3a
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140491
HGNC: HGNC:9291
Homologene: 48124
Cd180
Name: CD180 antigen
Synonyms: RP105, Ly78
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17079
HGNC: HGNC:6726
Homologene: 4077
Astn2
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56079
Homologene: 77850
Kctd7
Name: potassium channel tetramerisation domain containing 7
Synonyms: 9430010P06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212919
Homologene: 17687
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Lpcat3
Name: lysophosphatidylcholine acyltransferase 3
Synonyms: Grcc3f, Oact5, Mboat5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14792
Homologene: 14678
Lipe
Name: lipase, hormone sensitive
Synonyms: HSL, 4933403G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16890
HGNC: HGNC:6621
Homologene: 3912
Fndc8
Name: fibronectin type III domain containing 8
Synonyms: 4930466G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78919
Homologene: 9716
Chd5
Name: chromodomain helicase DNA binding protein 5
Synonyms: B230399N07Rik, 4930532L22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269610
Homologene: 56712
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
4933427I04Rik
Name: Riken cDNA 4933427I04 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 115489902
VEGA: 4
Mical2
Name: microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms: 5330438E18Rik, Ebitein1, 4921517J23Rik, Micalcl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320878
Homologene: 8760
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Sytl2
Name: synaptotagmin-like 2
Synonyms: Slp2-a, Slp2, Slp2-d, Slp2-c, Slp2-b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83671
Homologene: 131343
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Vmn2r92
Name: vomeronasal 2, receptor 92
Synonyms: EG627111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627111
Homologene: 115024
Ttc14
Name: tetratricopeptide repeat domain 14
Synonyms: cI-44, 4931403I22Rik, 4933402I15Rik, 4930434D01Rik, 2700016E08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67120
Homologene: 12085
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Synonyms: CEFIP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Prss40
Name: serine protease 40
Synonyms: Tesp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21756
Homologene: 69043
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Itih3
Name: inter-alpha trypsin inhibitor, heavy chain 3
Synonyms: Intin3, Itih-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16426
HGNC: HGNC:6168
Homologene: 1669
Ift88
Name: intraflagellar transport 88
Synonyms: Tg737, polaris, Oak Ridge polycystic kidneys, orpk, IFT88, fxo, TgN737Rpw, Tg737Rpw, Ttc10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21821
Homologene: 4761
Vmn1r43
Name: vomeronasal 1 receptor 43
Synonyms: V1ra5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113847
Homologene: 130651
Or8k16
Name: olfactory receptor family 8 subfamily K member 16
Synonyms: GA_x6K02T2Q125-47170431-47171372, MOR187-3, Olfr1008
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258866
Gpsm2
Name: G-protein signalling modulator 2 (AGS3-like, C. elegans)
Synonyms: Pins, 6230410J09Rik, LGN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76123
Homologene: 56584
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Or8b39
Name: olfactory receptor family 8 subfamily B member 39
Synonyms: GA_x6K02T2PVTD-31764095-31765024, MOR162-5, Olfr887
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258415
Homologene: 133625
Gzme
Name: granzyme E
Synonyms: MCSP-2, CCP3, Ctla-6, Ctla6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14942
VEGA: 14
Homologene: 133275
Slc25a23
Name: solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms: 2310067G05Rik, SCaMC-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66972
Homologene: 11467
Spata31e1
Name: spermatogenesis associated 31 subfamily E member 1
Synonyms: Gm30302
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102632152
VEGA: 13
Homologene: 141176
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 34,552,713 bp (GRCm38)
  • T to A, chromosome 1 at 60,525,995 bp (GRCm38)
  • A to G, chromosome 2 at 60,452,400 bp (GRCm38)
  • G to C, chromosome 2 at 85,690,051 bp (GRCm38)
  • A to G, chromosome 3 at 33,804,707 bp (GRCm38)
  • C to T, chromosome 3 at 97,205,973 bp (GRCm38)
  • G to A, chromosome 3 at 108,682,774 bp (GRCm38)
  • T to C, chromosome 4 at 65,746,351 bp (GRCm38)
  • T to A, chromosome 4 at 123,860,620 bp (GRCm38)
  • C to T, chromosome 4 at 152,384,135 bp (GRCm38)
  • A to C, chromosome 5 at 53,108,144 bp (GRCm38)
  • T to A, chromosome 5 at 62,606,112 bp (GRCm38)
  • A to T, chromosome 5 at 88,649,866 bp (GRCm38)
  • A to T, chromosome 5 at 129,594,622 bp (GRCm38)
  • T to C, chromosome 5 at 130,148,192 bp (GRCm38)
  • A to G, chromosome 6 at 14,755,011 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp (GRCm38)
  • A to G, chromosome 6 at 113,803,752 bp (GRCm38)
  • T to C, chromosome 6 at 124,663,320 bp (GRCm38)
  • A to T, chromosome 7 at 19,633,917 bp (GRCm38)
  • A to T, chromosome 7 at 25,397,802 bp (GRCm38)
  • T to A, chromosome 7 at 90,392,450 bp (GRCm38)
  • C to T, chromosome 7 at 112,346,875 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GGGACCAGCTCAGCCACG to GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG, chromosome 7 at 126,467,572 bp (GRCm38)
  • AGCTCAGCC to AGCTCAGCCCCGGGGACCCGCTCAGCC, chromosome 7 at 126,467,578 bp (GRCm38)
  • GG to GGCACCAGCTCAGCCCCGCG, chromosome 7 at 126,467,590 bp (GRCm38)
  • T to A, chromosome 8 at 56,089,044 bp (GRCm38)
  • T to C, chromosome 8 at 122,891,440 bp (GRCm38)
  • A to G, chromosome 9 at 21,575,495 bp (GRCm38)
  • A to G, chromosome 9 at 38,085,724 bp (GRCm38)
  • T to C, chromosome 9 at 102,729,332 bp (GRCm38)
  • C to T, chromosome 10 at 77,080,750 bp (GRCm38)
  • T to A, chromosome 10 at 79,378,934 bp (GRCm38)
  • C to T, chromosome 10 at 80,156,376 bp (GRCm38)
  • A to T, chromosome 11 at 82,897,913 bp (GRCm38)
  • T to A, chromosome 13 at 49,786,699 bp (GRCm38)
  • C to T, chromosome 13 at 55,156,480 bp (GRCm38)
  • G to T, chromosome 13 at 100,704,480 bp (GRCm38)
  • A to T, chromosome 13 at 102,705,513 bp (GRCm38)
  • T to C, chromosome 14 at 30,921,378 bp (GRCm38)
  • A to C, chromosome 14 at 32,662,658 bp (GRCm38)
  • C to T, chromosome 14 at 45,657,660 bp (GRCm38)
  • T to A, chromosome 14 at 56,118,339 bp (GRCm38)
  • T to A, chromosome 14 at 57,479,928 bp (GRCm38)
  • A to C, chromosome 15 at 23,173,813 bp (GRCm38)
  • T to A, chromosome 17 at 18,168,875 bp (GRCm38)
  • C to A, chromosome 17 at 57,053,930 bp (GRCm38)
  • G to T, chromosome 17 at 78,957,290 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9399 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069203-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.