Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9399Btlr/Mmmh
Stock Number:
069203-MU
Citation ID:
RRID:MMRRC_069203-MU
Other Names:
R9399 (G1)
Major Collection:

Strain Information

Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Cdk7
Name: cyclin dependent kinase 7
Synonyms: CRK4 PK (CDC2-related-kinase-4 protein kinase), Crk4, Cdkn7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12572
VEGA: 13
HGNC: HGNC:1778
Homologene: 1363
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Clptm1
Name: cleft lip and palate associated transmembrane protein 1
Synonyms: N14, HS9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56457
HGNC: HGNC:2087
Homologene: 37464
Rufy3
Name: RUN and FYVE domain containing 3
Synonyms: 2810428M05Rik, 6330416M07Rik, D5Bwg0860e, Rpipx
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52822
Homologene: 87809
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 34,552,713 bp (GRCm38)
  • T to A, chromosome 1 at 60,525,995 bp (GRCm38)
  • A to G, chromosome 2 at 60,452,400 bp (GRCm38)
  • G to C, chromosome 2 at 85,690,051 bp (GRCm38)
  • A to G, chromosome 3 at 33,804,707 bp (GRCm38)
  • C to T, chromosome 3 at 97,205,973 bp (GRCm38)
  • G to A, chromosome 3 at 108,682,774 bp (GRCm38)
  • T to C, chromosome 4 at 65,746,351 bp (GRCm38)
  • T to A, chromosome 4 at 123,860,620 bp (GRCm38)
  • C to T, chromosome 4 at 152,384,135 bp (GRCm38)
  • A to C, chromosome 5 at 53,108,144 bp (GRCm38)
  • T to A, chromosome 5 at 62,606,112 bp (GRCm38)
  • A to T, chromosome 5 at 88,649,866 bp (GRCm38)
  • A to T, chromosome 5 at 129,594,622 bp (GRCm38)
  • T to C, chromosome 5 at 130,148,192 bp (GRCm38)
  • A to G, chromosome 6 at 14,755,011 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp (GRCm38)
  • A to G, chromosome 6 at 113,803,752 bp (GRCm38)
  • T to C, chromosome 6 at 124,663,320 bp (GRCm38)
  • A to T, chromosome 7 at 19,633,917 bp (GRCm38)
  • A to T, chromosome 7 at 25,397,802 bp (GRCm38)
  • T to A, chromosome 7 at 90,392,450 bp (GRCm38)
  • C to T, chromosome 7 at 112,346,875 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GGGACCAGCTCAGCCACG to GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG, chromosome 7 at 126,467,572 bp (GRCm38)
  • AGCTCAGCC to AGCTCAGCCCCGGGGACCCGCTCAGCC, chromosome 7 at 126,467,578 bp (GRCm38)
  • GG to GGCACCAGCTCAGCCCCGCG, chromosome 7 at 126,467,590 bp (GRCm38)
  • T to A, chromosome 8 at 56,089,044 bp (GRCm38)
  • T to C, chromosome 8 at 122,891,440 bp (GRCm38)
  • A to G, chromosome 9 at 21,575,495 bp (GRCm38)
  • A to G, chromosome 9 at 38,085,724 bp (GRCm38)
  • T to C, chromosome 9 at 102,729,332 bp (GRCm38)
  • C to T, chromosome 10 at 77,080,750 bp (GRCm38)
  • T to A, chromosome 10 at 79,378,934 bp (GRCm38)
  • C to T, chromosome 10 at 80,156,376 bp (GRCm38)
  • A to T, chromosome 11 at 82,897,913 bp (GRCm38)
  • T to A, chromosome 13 at 49,786,699 bp (GRCm38)
  • C to T, chromosome 13 at 55,156,480 bp (GRCm38)
  • G to T, chromosome 13 at 100,704,480 bp (GRCm38)
  • A to T, chromosome 13 at 102,705,513 bp (GRCm38)
  • T to C, chromosome 14 at 30,921,378 bp (GRCm38)
  • A to C, chromosome 14 at 32,662,658 bp (GRCm38)
  • C to T, chromosome 14 at 45,657,660 bp (GRCm38)
  • T to A, chromosome 14 at 56,118,339 bp (GRCm38)
  • T to A, chromosome 14 at 57,479,928 bp (GRCm38)
  • A to C, chromosome 15 at 23,173,813 bp (GRCm38)
  • T to A, chromosome 17 at 18,168,875 bp (GRCm38)
  • C to A, chromosome 17 at 57,053,930 bp (GRCm38)
  • G to T, chromosome 17 at 78,957,290 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9399 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069203-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.