Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9403Btlr/Mmmh
Stock Number:
069207-MU
Citation ID:
RRID:MMRRC_069207-MU
Other Names:
R9403 (G1)
Major Collection:

Strain Information

Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, Apoav, 1300007O05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66113
Homologene: 14197
Txndc2
Name: thioredoxin domain containing 2 (spermatozoa)
Synonyms: Sptrx-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213272
VEGA: 17
Homologene: 41856
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Slc2a3
Name: solute carrier family 2 (facilitated glucose transporter), member 3
Synonyms: Glut-3, Glut3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20527
Homologene: 74302
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 9,745,824 bp (GRCm38)
  • T to C, chromosome 1 at 37,995,778 bp (GRCm38)
  • A to T, chromosome 1 at 97,062,523 bp (GRCm38)
  • A to G, chromosome 1 at 155,782,597 bp (GRCm38)
  • T to C, chromosome 2 at 15,614,177 bp (GRCm38)
  • T to A, chromosome 2 at 79,325,660 bp (GRCm38)
  • C to T, chromosome 2 at 151,938,972 bp (GRCm38)
  • C to A, chromosome 3 at 93,395,042 bp (GRCm38)
  • T to C, chromosome 4 at 24,580,204 bp (GRCm38)
  • T to C, chromosome 4 at 140,810,532 bp (GRCm38)
  • A to G, chromosome 5 at 9,121,927 bp (GRCm38)
  • T to A, chromosome 5 at 145,702,198 bp (GRCm38)
  • T to C, chromosome 6 at 31,432,970 bp (GRCm38)
  • G to A, chromosome 6 at 35,199,974 bp (GRCm38)
  • T to G, chromosome 6 at 96,165,299 bp (GRCm38)
  • A to C, chromosome 6 at 122,736,610 bp (GRCm38)
  • T to A, chromosome 6 at 139,494,854 bp (GRCm38)
  • T to C, chromosome 7 at 29,915,259 bp (GRCm38)
  • T to C, chromosome 7 at 30,977,090 bp (GRCm38)
  • T to A, chromosome 7 at 38,520,148 bp (GRCm38)
  • T to C, chromosome 7 at 38,522,256 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GGACCAGCTCAG to GGACCAGCTCAGTCACGGTGACCAGCTCAG, chromosome 7 at 126,467,573 bp (GRCm38)
  • ACCAGCTCAGCCACGGGG to ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG, chromosome 7 at 126,467,575 bp (GRCm38)
  • T to C, chromosome 7 at 135,168,396 bp (GRCm38)
  • T to A, chromosome 8 at 65,014,576 bp (GRCm38)
  • C to T, chromosome 8 at 111,187,793 bp (GRCm38)
  • C to T, chromosome 9 at 13,621,673 bp (GRCm38)
  • A to G, chromosome 9 at 18,537,764 bp (GRCm38)
  • G to C, chromosome 9 at 46,270,646 bp (GRCm38)
  • C to A, chromosome 9 at 123,052,772 bp (GRCm38)
  • C to T, chromosome 10 at 22,067,941 bp (GRCm38)
  • A to G, chromosome 13 at 16,017,381 bp (GRCm38)
  • T to C, chromosome 13 at 21,133,695 bp (GRCm38)
  • G to A, chromosome 13 at 24,979,729 bp (GRCm38)
  • G to A, chromosome 13 at 59,601,003 bp (GRCm38)
  • T to A, chromosome 13 at 100,219,830 bp (GRCm38)
  • T to A, chromosome 14 at 23,543,077 bp (GRCm38)
  • A to G, chromosome 14 at 44,853,258 bp (GRCm38)
  • T to C, chromosome 14 at 49,929,449 bp (GRCm38)
  • C to G, chromosome 15 at 39,828,071 bp (GRCm38)
  • C to A, chromosome 16 at 34,875,642 bp (GRCm38)
  • T to C, chromosome 16 at 37,061,853 bp (GRCm38)
  • A to T, chromosome 17 at 54,276,641 bp (GRCm38)
  • G to A, chromosome 17 at 65,637,997 bp (GRCm38)
  • T to C, chromosome 18 at 58,066,107 bp (GRCm38)
  • C to A, chromosome 19 at 18,832,652 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9403 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069207-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.