Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9405Btlr/Mmmh
Stock Number:
069209-MU
Citation ID:
RRID:MMRRC_069209-MU
Other Names:
R9405 (G1)
Major Collection:

Strain Information

Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
H2bc3
Name: H2B clustered histone 3
Synonyms: H2b-143, Hist1h2bb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319178
HGNC: HGNC:4751
Homologene: 137348
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 34,499,263 bp (GRCm38)
  • T to A, chromosome 1 at 60,310,265 bp (GRCm38)
  • T to A, chromosome 2 at 111,316,115 bp (GRCm38)
  • G to A, chromosome 2 at 112,834,267 bp (GRCm38)
  • G to T, chromosome 3 at 20,082,930 bp (GRCm38)
  • A to T, chromosome 3 at 87,752,583 bp (GRCm38)
  • G to A, chromosome 3 at 92,708,005 bp (GRCm38)
  • A to G, chromosome 3 at 92,824,253 bp (GRCm38)
  • G to A, chromosome 3 at 122,953,269 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • C to T, chromosome 6 at 7,689,283 bp (GRCm38)
  • T to A, chromosome 6 at 56,072,214 bp (GRCm38)
  • T to A, chromosome 6 at 65,456,094 bp (GRCm38)
  • T to G, chromosome 6 at 69,544,541 bp (GRCm38)
  • C to T, chromosome 6 at 127,967,161 bp (GRCm38)
  • G to A, chromosome 7 at 114,223,223 bp (GRCm38)
  • A to G, chromosome 7 at 126,585,532 bp (GRCm38)
  • C to T, chromosome 8 at 11,005,061 bp (GRCm38)
  • T to A, chromosome 8 at 61,972,214 bp (GRCm38)
  • C to T, chromosome 8 at 94,473,024 bp (GRCm38)
  • A to G, chromosome 8 at 113,703,398 bp (GRCm38)
  • A to T, chromosome 9 at 15,863,151 bp (GRCm38)
  • A to T, chromosome 9 at 36,782,841 bp (GRCm38)
  • A to G, chromosome 9 at 76,491,421 bp (GRCm38)
  • T to A, chromosome 9 at 119,149,438 bp (GRCm38)
  • AC to A, chromosome 10 at 4,450,848 bp (GRCm38)
  • A to G, chromosome 10 at 5,202,030 bp (GRCm38)
  • G to A, chromosome 10 at 8,762,230 bp (GRCm38)
  • T to C, chromosome 10 at 81,349,424 bp (GRCm38)
  • T to C, chromosome 10 at 128,278,765 bp (GRCm38)
  • A to C, chromosome 10 at 128,918,068 bp (GRCm38)
  • T to A, chromosome 10 at 129,174,296 bp (GRCm38)
  • T to C, chromosome 10 at 130,425,346 bp (GRCm38)
  • G to A, chromosome 11 at 77,132,108 bp (GRCm38)
  • A to T, chromosome 11 at 100,132,135 bp (GRCm38)
  • A to T, chromosome 11 at 106,544,388 bp (GRCm38)
  • T to G, chromosome 11 at 115,000,761 bp (GRCm38)
  • A to G, chromosome 11 at 118,118,911 bp (GRCm38)
  • T to C, chromosome 12 at 40,177,114 bp (GRCm38)
  • A to G, chromosome 12 at 73,046,321 bp (GRCm38)
  • T to G, chromosome 12 at 84,974,239 bp (GRCm38)
  • T to C, chromosome 13 at 22,088,728 bp (GRCm38)
  • T to C, chromosome 13 at 23,747,158 bp (GRCm38)
  • T to C, chromosome 13 at 100,813,908 bp (GRCm38)
  • G to A, chromosome 14 at 53,033,258 bp (GRCm38)
  • A to T, chromosome 15 at 25,984,949 bp (GRCm38)
  • T to A, chromosome 15 at 28,272,160 bp (GRCm38)
  • T to A, chromosome 15 at 47,675,791 bp (GRCm38)
  • A to T, chromosome 15 at 93,502,980 bp (GRCm38)
  • T to A, chromosome 15 at 98,227,031 bp (GRCm38)
  • A to G, chromosome 15 at 100,195,876 bp (GRCm38)
  • T to G, chromosome 16 at 14,188,391 bp (GRCm38)
  • T to A, chromosome 16 at 14,706,725 bp (GRCm38)
  • T to C, chromosome 16 at 57,192,622 bp (GRCm38)
  • T to A, chromosome 16 at 62,811,897 bp (GRCm38)
  • T to C, chromosome 16 at 93,845,148 bp (GRCm38)
  • A to G, chromosome 17 at 26,439,291 bp (GRCm38)
  • C to T, chromosome 18 at 31,976,303 bp (GRCm38)
  • C to A, chromosome 18 at 33,810,218 bp (GRCm38)
  • T to A, chromosome 18 at 43,767,064 bp (GRCm38)
  • T to G, chromosome 19 at 17,216,344 bp (GRCm38)
  • T to G, chromosome 19 at 32,008,645 bp (GRCm38)
  • T to C, chromosome 19 at 46,308,400 bp (GRCm38)
  • T to A, chromosome 19 at 47,135,669 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9405 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069209-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.