Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9405Btlr/Mmmh
Stock Number:
069209-MU
Citation ID:
RRID:MMRRC_069209-MU
Other Names:
R9405 (G1)
Major Collection:

Strain Information

Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
H2bc3
Name: H2B clustered histone 3
Synonyms: H2b-143, Hist1h2bb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319178
HGNC: HGNC:4751
Homologene: 137348
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Copb1
Name: coatomer protein complex, subunit beta 1
Synonyms: Copb1, 2610019B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70349
HGNC: HGNC:2231
Homologene: 5664
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, Def-5, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Tbc1d23
Name: TBC1 domain family, member 23
Synonyms: 4930451A13Rik, D030022P07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67581
VEGA: 16
Homologene: 10126
Hmg20b
Name: high mobility group 20B
Synonyms: Smarce1r, Hmgx2, BRCA2-associated factor 35, BRAF35, Hmgxb2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15353
HGNC: HGNC:5002
Homologene: 74949
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: Sp6, Phxr3, mbo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ei24
Name: etoposide induced 2.4 mRNA
Synonyms: PIG8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13663
Homologene: 3588
Zfp622
Name: zinc finger protein 622
Synonyms: 1110033B05Rik, ZPR9, D15Ertd806e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 52521
VEGA: 15
Homologene: 74377
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: Zntl1, ZnT-5, ZTL1, 1810010K08Rik, Znt5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Armt1
Name: acidic residue methyltransferase 1
Synonyms: 1700052N19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73419
Homologene: 41557
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Qrfprl
Name: pyroglutamylated RFamide peptide receptor like
Synonyms: C130060K24Rik, Gpr103b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243407
Homologene: 135976
Arl13b
Name: ADP-ribosylation factor-like 13B
Synonyms: A930014M17Rik, A530097K21Rik, C530009C10Rik, Arl2l1, hnn
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68146
Homologene: 18820
Prickle1
Name: prickle planar cell polarity protein 1
Synonyms: 1110058P22Rik, mpk1, b2b019Clo, Pk1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106042
Homologene: 17686
Nfkb2
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonyms: p52, NF kappaB2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18034
VEGA: 19
HGNC: HGNC:7795
Homologene: 1873
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Asns
Name: asparagine synthetase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27053
HGNC: HGNC:753
Homologene: 69113
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73182
Homologene: 12492
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Kprp
Name: keratinocyte expressed, proline-rich
Synonyms: 1110001M24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433619
Homologene: 54921
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
Vmn2r85
Name: vomeronasal 2, receptor 85
Synonyms: EG623734
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 623734
Homologene: 129606
Hltf
Name: helicase-like transcription factor
Synonyms: P113, Snf2l3, Smarca3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20585
Homologene: 30136
Or4k36
Name: olfactory receptor family 4 subfamily K member 36
Synonyms: GA_x6K02T2Q125-72366920-72367837, MOR248-1, Olfr1280
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258910
Homologene: 121540
Tspan9
Name: tetraspanin 9
Synonyms: 6720474K14Rik, 9430079M16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109246
Homologene: 4860
Ddx60
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234311
Homologene: 23031
Stat2
Name: signal transducer and activator of transcription 2
Synonyms: 1600010G07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20847
VEGA: 10
Homologene: 3952
Fam83b
Name: family with sequence similarity 83, member B
Synonyms: C530008M07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208994
Homologene: 19478
Adamts18
Name: ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms: E130314N14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 208936
Homologene: 65241
Prss39
Name: serine protease 39
Synonyms: Tesp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21755
Homologene: 84781
Efcab5
Name: EF-hand calcium binding domain 5
Synonyms: 4930563A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319634
Homologene: 63366
Acaa1b
Name: acetyl-Coenzyme A acyltransferase 1B
Synonyms: thiolase B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235674
HGNC: HGNC:82
Homologene: 91131
Krt15
Name: keratin 15
Synonyms: K15, Krt1-15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16665
HGNC: HGNC:6421
Homologene: 1712
Mtnr1b
Name: melatonin receptor 1B
Synonyms: Mel1b, Mt2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244701
HGNC: HGNC:7464
Homologene: 4350
Calhm2
Name: calcium homeostasis modulator family member 2
Synonyms: 2810048G17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72691
Homologene: 9303
Six1
Name: sine oculis-related homeobox 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20471
Homologene: 4360
Fcf1
Name: FCF1 rRNA processing protein
Synonyms: 1110008B24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73736
Homologene: 5706
Neurl1b
Name: neuralized E3 ubiquitin protein ligase 1B
Synonyms: EG240055, Neur2, C230078M08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240055
Homologene: 35443
Apobr
Name: apolipoprotein B receptor
Synonyms: Apob-48r, Apob48r
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171504
Homologene: 26695
Lce1e
Name: late cornified envelope 1E
Synonyms: 1110031B11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68694
Snai2
Name: snail family zinc finger 2
Synonyms: Slugh, Slug, Snail2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20583
VEGA: 16
Homologene: 31127
Or10ad1b
Name: olfactory receptor family 10 subfamily AD member 1B
Synonyms: GA_x6K02T2NBG7-5528233-5529186, MOR286-2, EG629524, Olfr286
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 629524
Homologene: 134078
Scgb3a2
Name: secretoglobin, family 3A, member 2
Synonyms: UGRP1, LuLeu1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 117158
Homologene: 14274
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Nde1
Name: nudE neurodevelopment protein 1
Synonyms: 2810027M15Rik, mNudE
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67203
Homologene: 32354
Vmn1r188
Name: vomeronasal 1 receptor 188
Synonyms: V1rh17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252912
Homologene: 110880
Or6c203
Name: olfactory receptor family 6 subfamily C member 203
Synonyms: GA_x6K02T2PULF-10860457-10859522, MOR114-3, Olfr772
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257666
Homologene: 123776
Cd300c2
Name: CD300C molecule 2
Synonyms: DIgR1, Clm4, LMIR2, Igsf7, Cd300d, MAIR-II, AF251705
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140497
Homologene: 74580
Rdh5
Name: retinol dehydrogenase 5
Synonyms: cRDH
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19682
HGNC: HGNC:9940
Homologene: 2179
Igkv4-57-1
Name: immunoglobulin kappa variable 4-57-1
Synonyms: LOC384514
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384514
Trav13d-3
Name: T cell receptor alpha variable 13D-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 667596
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 34,499,263 bp (GRCm38)
  • T to A, chromosome 1 at 60,310,265 bp (GRCm38)
  • T to A, chromosome 2 at 111,316,115 bp (GRCm38)
  • G to A, chromosome 2 at 112,834,267 bp (GRCm38)
  • G to T, chromosome 3 at 20,082,930 bp (GRCm38)
  • A to T, chromosome 3 at 87,752,583 bp (GRCm38)
  • G to A, chromosome 3 at 92,708,005 bp (GRCm38)
  • A to G, chromosome 3 at 92,824,253 bp (GRCm38)
  • G to A, chromosome 3 at 122,953,269 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • C to T, chromosome 6 at 7,689,283 bp (GRCm38)
  • T to A, chromosome 6 at 56,072,214 bp (GRCm38)
  • T to A, chromosome 6 at 65,456,094 bp (GRCm38)
  • T to G, chromosome 6 at 69,544,541 bp (GRCm38)
  • C to T, chromosome 6 at 127,967,161 bp (GRCm38)
  • G to A, chromosome 7 at 114,223,223 bp (GRCm38)
  • A to G, chromosome 7 at 126,585,532 bp (GRCm38)
  • C to T, chromosome 8 at 11,005,061 bp (GRCm38)
  • T to A, chromosome 8 at 61,972,214 bp (GRCm38)
  • C to T, chromosome 8 at 94,473,024 bp (GRCm38)
  • A to G, chromosome 8 at 113,703,398 bp (GRCm38)
  • A to T, chromosome 9 at 15,863,151 bp (GRCm38)
  • A to T, chromosome 9 at 36,782,841 bp (GRCm38)
  • A to G, chromosome 9 at 76,491,421 bp (GRCm38)
  • T to A, chromosome 9 at 119,149,438 bp (GRCm38)
  • AC to A, chromosome 10 at 4,450,848 bp (GRCm38)
  • A to G, chromosome 10 at 5,202,030 bp (GRCm38)
  • G to A, chromosome 10 at 8,762,230 bp (GRCm38)
  • T to C, chromosome 10 at 81,349,424 bp (GRCm38)
  • T to C, chromosome 10 at 128,278,765 bp (GRCm38)
  • A to C, chromosome 10 at 128,918,068 bp (GRCm38)
  • T to A, chromosome 10 at 129,174,296 bp (GRCm38)
  • T to C, chromosome 10 at 130,425,346 bp (GRCm38)
  • G to A, chromosome 11 at 77,132,108 bp (GRCm38)
  • A to T, chromosome 11 at 100,132,135 bp (GRCm38)
  • A to T, chromosome 11 at 106,544,388 bp (GRCm38)
  • T to G, chromosome 11 at 115,000,761 bp (GRCm38)
  • A to G, chromosome 11 at 118,118,911 bp (GRCm38)
  • T to C, chromosome 12 at 40,177,114 bp (GRCm38)
  • A to G, chromosome 12 at 73,046,321 bp (GRCm38)
  • T to G, chromosome 12 at 84,974,239 bp (GRCm38)
  • T to C, chromosome 13 at 22,088,728 bp (GRCm38)
  • T to C, chromosome 13 at 23,747,158 bp (GRCm38)
  • T to C, chromosome 13 at 100,813,908 bp (GRCm38)
  • G to A, chromosome 14 at 53,033,258 bp (GRCm38)
  • A to T, chromosome 15 at 25,984,949 bp (GRCm38)
  • T to A, chromosome 15 at 28,272,160 bp (GRCm38)
  • T to A, chromosome 15 at 47,675,791 bp (GRCm38)
  • A to T, chromosome 15 at 93,502,980 bp (GRCm38)
  • T to A, chromosome 15 at 98,227,031 bp (GRCm38)
  • A to G, chromosome 15 at 100,195,876 bp (GRCm38)
  • T to G, chromosome 16 at 14,188,391 bp (GRCm38)
  • T to A, chromosome 16 at 14,706,725 bp (GRCm38)
  • T to C, chromosome 16 at 57,192,622 bp (GRCm38)
  • T to A, chromosome 16 at 62,811,897 bp (GRCm38)
  • T to C, chromosome 16 at 93,845,148 bp (GRCm38)
  • A to G, chromosome 17 at 26,439,291 bp (GRCm38)
  • C to T, chromosome 18 at 31,976,303 bp (GRCm38)
  • C to A, chromosome 18 at 33,810,218 bp (GRCm38)
  • T to A, chromosome 18 at 43,767,064 bp (GRCm38)
  • T to G, chromosome 19 at 17,216,344 bp (GRCm38)
  • T to G, chromosome 19 at 32,008,645 bp (GRCm38)
  • T to C, chromosome 19 at 46,308,400 bp (GRCm38)
  • T to A, chromosome 19 at 47,135,669 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9405 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069209-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.