Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9420Btlr/Mmmh
Stock Number:
069224-MU
Citation ID:
RRID:MMRRC_069224-MU
Other Names:
R9420 (G1)
Major Collection:

Strain Information

Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Ift70b
Name: intraflagellar transport 70B
Synonyms: 2510042P03Rik, Ttc30b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72421
Homologene: 71716
Gck
Name: glucokinase
Synonyms: hexokinase 4, MODY2, HK4, Gls006, Hlb62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103988
HGNC: HGNC:4195
Homologene: 55440
Luc7l2
Name: LUC7-like 2 (S. cerevisiae)
Synonyms: CGI-74, CGI-59, 4930471C18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 192196
Homologene: 56737
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 2 at 14,307,979 bp (GRCm38)
  • C to T, chromosome 2 at 34,213,336 bp (GRCm38)
  • T to A, chromosome 2 at 75,938,047 bp (GRCm38)
  • T to A, chromosome 2 at 76,791,543 bp (GRCm38)
  • T to A, chromosome 2 at 76,919,969 bp (GRCm38)
  • T to C, chromosome 2 at 89,844,371 bp (GRCm38)
  • T to A, chromosome 2 at 91,135,133 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to C, chromosome 2 at 131,151,762 bp (GRCm38)
  • A to G, chromosome 2 at 154,510,506 bp (GRCm38)
  • A to T, chromosome 2 at 157,193,234 bp (GRCm38)
  • A to G, chromosome 3 at 55,783,253 bp (GRCm38)
  • A to T, chromosome 3 at 132,948,105 bp (GRCm38)
  • A to G, chromosome 4 at 32,678,414 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • T to C, chromosome 4 at 126,751,969 bp (GRCm38)
  • A to G, chromosome 4 at 148,938,863 bp (GRCm38)
  • T to C, chromosome 5 at 33,769,458 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC to AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC, chromosome 5 at 134,711,081 bp (GRCm38)
  • A to G, chromosome 5 at 150,433,529 bp (GRCm38)
  • T to C, chromosome 6 at 38,570,554 bp (GRCm38)
  • T to A, chromosome 6 at 129,094,457 bp (GRCm38)
  • T to C, chromosome 6 at 136,814,261 bp (GRCm38)
  • T to C, chromosome 6 at 137,443,935 bp (GRCm38)
  • T to A, chromosome 7 at 19,091,021 bp (GRCm38)
  • GGCGGCGGC to GGCGGCGGCCGCGGCGGC, chromosome 7 at 97,579,927 bp (GRCm38)
  • A to T, chromosome 7 at 100,416,055 bp (GRCm38)
  • T to C, chromosome 7 at 103,929,773 bp (GRCm38)
  • T to C, chromosome 7 at 122,003,972 bp (GRCm38)
  • C to T, chromosome 7 at 130,815,786 bp (GRCm38)
  • A to T, chromosome 8 at 64,752,836 bp (GRCm38)
  • A to G, chromosome 8 at 78,333,761 bp (GRCm38)
  • A to G, chromosome 9 at 44,356,422 bp (GRCm38)
  • C to A, chromosome 9 at 87,730,622 bp (GRCm38)
  • T to A, chromosome 9 at 119,386,362 bp (GRCm38)
  • A to G, chromosome 10 at 51,615,410 bp (GRCm38)
  • A to G, chromosome 11 at 3,712,170 bp (GRCm38)
  • A to G, chromosome 11 at 5,949,553 bp (GRCm38)
  • A to G, chromosome 11 at 30,935,054 bp (GRCm38)
  • A to T, chromosome 11 at 46,456,523 bp (GRCm38)
  • A to T, chromosome 11 at 69,478,116 bp (GRCm38)
  • A to T, chromosome 11 at 83,942,182 bp (GRCm38)
  • A to G, chromosome 11 at 116,132,450 bp (GRCm38)
  • A to G, chromosome 11 at 120,021,451 bp (GRCm38)
  • G to C, chromosome 12 at 104,240,259 bp (GRCm38)
  • A to G, chromosome 12 at 111,772,516 bp (GRCm38)
  • A to G, chromosome 13 at 4,275,797 bp (GRCm38)
  • T to G, chromosome 13 at 12,253,878 bp (GRCm38)
  • T to C, chromosome 13 at 50,472,928 bp (GRCm38)
  • A to T, chromosome 14 at 27,441,970 bp (GRCm38)
  • C to A, chromosome 15 at 38,493,627 bp (GRCm38)
  • G to A, chromosome 16 at 55,821,974 bp (GRCm38)
  • G to C, chromosome 16 at 91,657,620 bp (GRCm38)
  • C to T, chromosome 17 at 29,325,925 bp (GRCm38)
  • T to C, chromosome 17 at 36,284,751 bp (GRCm38)
  • T to A, chromosome 17 at 37,481,324 bp (GRCm38)
  • T to A, chromosome 17 at 40,783,833 bp (GRCm38)
  • C to A, chromosome 17 at 56,512,218 bp (GRCm38)
  • C to A, chromosome 17 at 65,485,886 bp (GRCm38)
  • C to A, chromosome 17 at 87,797,079 bp (GRCm38)
  • T to C, chromosome 18 at 37,731,785 bp (GRCm38)
  • A to G, chromosome 19 at 6,531,901 bp (GRCm38)
  • T to C, chromosome 19 at 42,059,894 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9420 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069224-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.