Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9449Btlr/Mmmh
Stock Number:
069252-MU
Citation ID:
RRID:MMRRC_069252-MU
Other Names:
R9449 (G1)
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Slc32a1
Name: solute carrier family 32 (GABA vesicular transporter), member 1
Synonyms: R75019, VGAT, Viaat
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22348
Homologene: 56451
Manba
Name: mannosidase, beta A, lysosomal
Synonyms: Bmn, 2410030O07Rik, B930014J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110173
HGNC: HGNC:6831
Homologene: 4317
Nr4a1
Name: nuclear receptor subfamily 4, group A, member 1
Synonyms: Nur77, TIS1, TR3, N10, NP10, GFRP1, NGFI-B, Hbr-1, Gfrp, Hbr1, Hmr
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15370
VEGA: 15
HGNC: HGNC:7980
Homologene: 1612
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 58,431,238 bp (GRCm38)
  • T to C, chromosome 1 at 67,220,512 bp (GRCm38)
  • A to T, chromosome 1 at 165,318,820 bp (GRCm38)
  • G to A, chromosome 1 at 174,391,176 bp (GRCm38)
  • A to G, chromosome 2 at 20,880,653 bp (GRCm38)
  • A to T, chromosome 2 at 60,428,558 bp (GRCm38)
  • T to A, chromosome 2 at 125,186,224 bp (GRCm38)
  • A to G, chromosome 2 at 126,777,897 bp (GRCm38)
  • T to C, chromosome 2 at 131,053,686 bp (GRCm38)
  • T to C, chromosome 2 at 158,614,321 bp (GRCm38)
  • T to A, chromosome 3 at 101,451,006 bp (GRCm38)
  • T to A, chromosome 3 at 107,105,571 bp (GRCm38)
  • A to T, chromosome 3 at 135,549,318 bp (GRCm38)
  • T to A, chromosome 4 at 47,104,163 bp (GRCm38)
  • A to T, chromosome 4 at 62,524,040 bp (GRCm38)
  • A to T, chromosome 4 at 86,595,428 bp (GRCm38)
  • C to A, chromosome 4 at 108,719,238 bp (GRCm38)
  • G to A, chromosome 4 at 151,010,488 bp (GRCm38)
  • C to A, chromosome 4 at 155,388,346 bp (GRCm38)
  • A to G, chromosome 5 at 134,673,010 bp (GRCm38)
  • A to G, chromosome 6 at 89,714,872 bp (GRCm38)
  • T to A, chromosome 6 at 115,955,769 bp (GRCm38)
  • T to C, chromosome 6 at 129,451,643 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • C to T, chromosome 7 at 27,276,902 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to C, chromosome 7 at 45,585,556 bp (GRCm38)
  • A to G, chromosome 7 at 84,114,429 bp (GRCm38)
  • T to C, chromosome 7 at 108,080,833 bp (GRCm38)
  • T to A, chromosome 7 at 119,952,250 bp (GRCm38)
  • C to G, chromosome 7 at 140,857,480 bp (GRCm38)
  • A to T, chromosome 8 at 54,157,018 bp (GRCm38)
  • A to T, chromosome 8 at 67,713,181 bp (GRCm38)
  • T to C, chromosome 8 at 90,932,546 bp (GRCm38)
  • A to G, chromosome 9 at 21,347,037 bp (GRCm38)
  • C to T, chromosome 10 at 88,356,841 bp (GRCm38)
  • A to T, chromosome 11 at 5,338,710 bp (GRCm38)
  • T to G, chromosome 11 at 48,945,739 bp (GRCm38)
  • T to C, chromosome 11 at 100,790,848 bp (GRCm38)
  • A to C, chromosome 11 at 101,410,771 bp (GRCm38)
  • A to G, chromosome 11 at 118,096,626 bp (GRCm38)
  • A to T, chromosome 12 at 16,977,762 bp (GRCm38)
  • A to G, chromosome 12 at 98,861,295 bp (GRCm38)
  • A to G, chromosome 12 at 103,315,848 bp (GRCm38)
  • A to G, chromosome 13 at 54,526,379 bp (GRCm38)
  • A to T, chromosome 13 at 61,538,485 bp (GRCm38)
  • A to G, chromosome 13 at 91,675,038 bp (GRCm38)
  • A to T, chromosome 14 at 54,952,322 bp (GRCm38)
  • A to G, chromosome 15 at 19,013,435 bp (GRCm38)
  • A to G, chromosome 15 at 39,084,473 bp (GRCm38)
  • A to T, chromosome 15 at 73,557,628 bp (GRCm38)
  • T to C, chromosome 15 at 101,270,172 bp (GRCm38)
  • T to C, chromosome 16 at 35,956,864 bp (GRCm38)
  • T to A, chromosome 16 at 91,828,376 bp (GRCm38)
  • C to T, chromosome 17 at 15,053,292 bp (GRCm38)
  • A to G, chromosome 17 at 23,386,945 bp (GRCm38)
  • T to C, chromosome 17 at 26,197,200 bp (GRCm38)
  • A to G, chromosome 18 at 37,012,431 bp (GRCm38)
  • G to A, chromosome 18 at 65,291,393 bp (GRCm38)
  • T to A, chromosome 19 at 4,988,464 bp (GRCm38)
  • T to A, chromosome 19 at 55,623,846 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9449 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069252-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.