Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9454Btlr/Mmmh
Stock Number:
069257-MU
Citation ID:
RRID:MMRRC_069257-MU
Other Names:
R9454 (G1)
Major Collection:

Strain Information

E2f7
Name: E2F transcription factor 7
Synonyms: A630014C11Rik, D10Ertd739e, E2F7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52679
Homologene: 18685
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Rfc1
Name: replication factor C (activator 1) 1
Synonyms: RFC140, Alp145, 140kDa, Recc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19687
HGNC: HGNC:9969
Homologene: 2187
Ralgapb
Name: Ral GTPase activating protein, beta subunit (non-catalytic)
Synonyms: B230339M05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228850
Homologene: 10666
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 60,489,594 bp (GRCm38)
  • C to A, chromosome 1 at 66,695,590 bp (GRCm38)
  • A to G, chromosome 1 at 67,180,152 bp (GRCm38)
  • A to G, chromosome 1 at 74,569,857 bp (GRCm38)
  • A to T, chromosome 1 at 74,905,051 bp (GRCm38)
  • G to A, chromosome 1 at 139,480,994 bp (GRCm38)
  • T to A, chromosome 1 at 170,961,088 bp (GRCm38)
  • T to C, chromosome 2 at 15,752,849 bp (GRCm38)
  • G to A, chromosome 2 at 15,797,726 bp (GRCm38)
  • A to T, chromosome 2 at 20,865,342 bp (GRCm38)
  • T to A, chromosome 2 at 26,276,102 bp (GRCm38)
  • A to T, chromosome 2 at 26,914,796 bp (GRCm38)
  • T to A, chromosome 2 at 75,976,468 bp (GRCm38)
  • A to T, chromosome 2 at 86,314,834 bp (GRCm38)
  • A to C, chromosome 2 at 90,149,476 bp (GRCm38)
  • T to C, chromosome 2 at 117,249,769 bp (GRCm38)
  • T to A, chromosome 2 at 158,473,152 bp (GRCm38)
  • T to C, chromosome 3 at 51,396,481 bp (GRCm38)
  • T to C, chromosome 3 at 95,889,770 bp (GRCm38)
  • T to C, chromosome 4 at 47,016,789 bp (GRCm38)
  • A to G, chromosome 4 at 120,515,079 bp (GRCm38)
  • A to G, chromosome 4 at 132,334,763 bp (GRCm38)
  • G to T, chromosome 4 at 140,580,925 bp (GRCm38)
  • T to A, chromosome 5 at 14,712,438 bp (GRCm38)
  • G to T, chromosome 5 at 20,466,178 bp (GRCm38)
  • T to A, chromosome 5 at 65,274,431 bp (GRCm38)
  • C to T, chromosome 5 at 99,923,093 bp (GRCm38)
  • A to T, chromosome 6 at 8,667,288 bp (GRCm38)
  • A to G, chromosome 6 at 82,554,872 bp (GRCm38)
  • T to C, chromosome 6 at 97,178,905 bp (GRCm38)
  • A to G, chromosome 6 at 104,804,347 bp (GRCm38)
  • T to C, chromosome 6 at 123,235,573 bp (GRCm38)
  • C to A, chromosome 6 at 129,906,723 bp (GRCm38)
  • T to C, chromosome 6 at 142,374,891 bp (GRCm38)
  • C to A, chromosome 6 at 146,618,543 bp (GRCm38)
  • T to C, chromosome 7 at 58,658,591 bp (GRCm38)
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,923 bp (GRCm38)
  • C to T, chromosome 7 at 141,808,694 bp (GRCm38)
  • C to A, chromosome 8 at 22,175,883 bp (GRCm38)
  • A to T, chromosome 8 at 40,754,449 bp (GRCm38)
  • A to G, chromosome 8 at 45,085,575 bp (GRCm38)
  • T to C, chromosome 8 at 57,958,401 bp (GRCm38)
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp (GRCm38)
  • T to A, chromosome 8 at 69,706,591 bp (GRCm38)
  • G to T, chromosome 8 at 116,889,811 bp (GRCm38)
  • G to A, chromosome 9 at 105,783,860 bp (GRCm38)
  • T to C, chromosome 9 at 106,483,641 bp (GRCm38)
  • A to G, chromosome 10 at 18,784,581 bp (GRCm38)
  • T to C, chromosome 10 at 110,000,003 bp (GRCm38)
  • C to T, chromosome 10 at 110,784,681 bp (GRCm38)
  • A to G, chromosome 11 at 9,038,281 bp (GRCm38)
  • G to T, chromosome 11 at 16,887,155 bp (GRCm38)
  • T to C, chromosome 11 at 36,221,459 bp (GRCm38)
  • C to A, chromosome 11 at 82,960,059 bp (GRCm38)
  • T to C, chromosome 12 at 30,940,421 bp (GRCm38)
  • AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA, chromosome 12 at 51,887,919 bp (GRCm38)
  • A to G, chromosome 12 at 76,020,501 bp (GRCm38)
  • A to T, chromosome 12 at 76,095,070 bp (GRCm38)
  • A to G, chromosome 13 at 23,901,927 bp (GRCm38)
  • G to A, chromosome 13 at 85,202,402 bp (GRCm38)
  • A to T, chromosome 13 at 96,780,334 bp (GRCm38)
  • T to C, chromosome 13 at 96,780,338 bp (GRCm38)
  • A to T, chromosome 14 at 24,296,792 bp (GRCm38)
  • A to G, chromosome 14 at 55,596,152 bp (GRCm38)
  • T to A, chromosome 15 at 85,818,219 bp (GRCm38)
  • T to C, chromosome 15 at 98,256,942 bp (GRCm38)
  • T to C, chromosome 16 at 11,984,659 bp (GRCm38)
  • C to A, chromosome 16 at 29,314,520 bp (GRCm38)
  • G to A, chromosome 17 at 23,607,645 bp (GRCm38)
  • A to G, chromosome 17 at 23,676,517 bp (GRCm38)
  • G to A, chromosome 17 at 34,183,104 bp (GRCm38)
  • A to T, chromosome 17 at 35,321,373 bp (GRCm38)
  • G to T, chromosome 18 at 61,818,996 bp (GRCm38)
  • T to C, chromosome 19 at 5,645,340 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9454 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069257-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.