Strain Name:
C57BL/6J-MtgxR9454Btlr/Mmmh
Stock Number:
069257-MU
Citation ID:
RRID:MMRRC_069257-MU
Other Names:
R9454 (G1)
Major Collection:

Strain Information

E2f7
Name: E2F transcription factor 7
Synonyms: A630014C11Rik, D10Ertd739e, E2F7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52679
Homologene: 18685
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Rfc1
Name: replication factor C (activator 1) 1
Synonyms: RFC140, Alp145, 140kDa, Recc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19687
HGNC: HGNC:9969
Homologene: 2187
Ralgapb
Name: Ral GTPase activating protein, beta subunit (non-catalytic)
Synonyms: B230339M05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228850
Homologene: 10666
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Ccnh
Name: cyclin H
Synonyms: 6330408H09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66671
HGNC: HGNC:1594
Homologene: 946
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Zfp869
Name: zinc finger protein 869
Synonyms: U 2-7-1, 1200003I07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66869
VEGA: 8
Homologene: 134644
Rcc1
Name: regulator of chromosome condensation 1
Synonyms: 4931417M11Rik, Chc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100088
HGNC: HGNC:1913
Homologene: 55567
Rrp9
Name: ribosomal RNA processing 9, U3 small nucleolar RNA binding protein
Synonyms: 55kDa, U3-55k, D9Wsu10e, Rnu3ip2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27966
Homologene: 3452
Egfr
Name: epidermal growth factor receptor
Synonyms: avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Wa5, 9030024J15Rik, Errb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Ccdc187
Name: coiled-coil domain containing 187
Synonyms: 4932418E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329366
Homologene: 77630
Atp13a5
Name: ATPase type 13A5
Synonyms: C630015F21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268878
Homologene: 77451
Scmh1
Name: sex comb on midleg homolog 1
Synonyms: Scml3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29871
Homologene: 32146
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Zfp142
Name: zinc finger protein 142
Synonyms: 9330177B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77264
Homologene: 3723
Raph1
Name: Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms: C730009O10Rik, 9430025M21Rik, lamellipodin, Lpd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77300
Homologene: 71030
Ckap2
Name: cytoskeleton associated protein 2
Synonyms: LB1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80986
HGNC: HGNC:1990
Homologene: 10070
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11982
Homologene: 56461
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Zscan10
Name: zinc finger and SCAN domain containing 10
Synonyms: Zscan10, Zfp206
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 332221
Homologene: 13122
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Ift70a2
Name: intraflagellar transport 70A2
Synonyms: OTTMUSG00000015167, Ttc30a2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 620631
Homologene: 44342
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Psmb9
Name: proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)
Synonyms: Lmp-2, Lmp2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16912
HGNC: HGNC:9546
Homologene: 2094
Tnfrsf12a
Name: tumor necrosis factor receptor superfamily, member 12a
Synonyms: Fn14, TweakR, TWEAK-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27279
VEGA: 17
Homologene: 8451
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Arhgef10l
Name: Rho guanine nucleotide exchange factor 10-like
Synonyms: 2810441C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72754
Homologene: 10017
Adam25
Name: ADAM metallopeptidase domain 25
Synonyms: testase 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23793
HGNC: HGNC:199
Homologene: 128364
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Ica1
Name: islet cell autoantigen 1
Synonyms: ICA69, 69kDa
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15893
HGNC: HGNC:5343
Homologene: 7777
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Mgarp
Name: mitochondria localized glutamic acid rich protein
Synonyms: Osap, 4930583H14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67749
Homologene: 49858
Ablim3
Name: actin binding LIM protein family, member 3
Synonyms: D930036B08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319713
VEGA: 18
Homologene: 69175
Mtnr1a
Name: melatonin receptor 1A
Synonyms: MelR, Mel1a receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17773
HGNC: HGNC:7463
Homologene: 21207
Gm4922
Name: predicted gene 4922
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237300
VEGA: 10
Homologene: 50497
Tmf1
Name: TATA element modulatory factor 1
Synonyms: LOC232286, 7030402D04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232286
Homologene: 133801
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Shisa9
Name: shisa family member 9
Synonyms: 2700045P11Rik, CKAMP44
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72555
Homologene: 109462
Rnf31
Name: ring finger protein 31
Synonyms: Paul, HOIP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268749
Homologene: 33228
Klra5
Name: killer cell lectin-like receptor, subfamily A, member 5
Synonyms: Ly49e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16636
Homologene: 110821
Recql
Name: RecQ protein-like
Synonyms: RecQ1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19691
HGNC: HGNC:9948
Homologene: 56279
H2-Q1
Name: histocompatibility 2, Q region locus 1
Synonyms: H-2Q1, Q1k, Q1d, Q1b, Q1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15006
Homologene: 128352
Fam98b
Name: family with sequence similarity 98, member B
Synonyms: 2610510H03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68215
Homologene: 72241
Cntn6
Name: contactin 6
Synonyms: NB-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53870
HGNC: HGNC:2176
Homologene: 8702
Slfn5
Name: schlafen 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327978
Homologene: 18839
Or8k21
Name: olfactory receptor family 8 subfamily K member 21
Synonyms: GA_x6K02T2Q125-47793414-47792471, MOR187-4, Olfr1053-ps1, Olfr1053
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257974
Homologene: 74197
E330034G19Rik
Name: RIKEN cDNA E330034G19 gene
Synonyms: ZPAC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105418
H1f7
Name: H1.7 linker histone
Synonyms: 1700026P10Rik, H1T2, H1fnt, H1-7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70069
VEGA: 15
Tacr1
Name: tachykinin receptor 1
Synonyms: neurokinin receptor 1, NK-1R, NK1-R, NK1 receptor, Tac1r, substance p receptor, SPr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21336
Homologene: 20288
Anks6
Name: ankyrin repeat and sterile alpha motif domain containing 6
Synonyms: LOC269533, 2210417J20Rik, Samd6, SamCystin, b2b1801.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75691
Homologene: 19545
Rela
Name: v-rel reticuloendotheliosis viral oncogene homolog A (avian)
Synonyms: p65 NF kappaB, p65
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19697
HGNC: HGNC:9955
Homologene: 32064
Or4b1
Name: olfactory receptor family 4 subfamily B member 1
Synonyms: GA_x6K02T2Q125-51584440-51583526, MOR227-1, Olfr1270
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258987
HGNC: HGNC:8290
Homologene: 133648
Galntl6
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms: 1700021K10Rik, 4930431L04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270049
Homologene: 65137
Fcgr2b
Name: Fc receptor, IgG, low affinity IIb
Synonyms: CD32, FcgRII, Fc[g]RII, Fc gamma RIIB, FcgammaRIIB, Fcgr2, Ly-m20, Ly-17, LyM-1, Fcr-2, Fcr-3, Fcgr2a, F630109E10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14130
Homologene: 2974
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: dectin-2, Clecsf10, Nkcl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56620
Homologene: 84615
Cmc2
Name: C-X9-C motif containing 2
Synonyms: 1110046L09Rik, 2310061C15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66531
Homologene: 41350
Surf1
Name: surfeit gene 1
Synonyms: Surf-1, 0610010F23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20930
Homologene: 2387
Slc17a4
Name: solute carrier family 17 (sodium phosphate), member 4
Synonyms: 9130214H05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319848
Homologene: 21127
Sun3
Name: Sad1 and UNC84 domain containing 3
Synonyms: D630047F21Rik, Sunc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 194974
Homologene: 51273
Sh3yl1
Name: Sh3 domain YSC-like 1
Synonyms: YSC84, Ray
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24057
Homologene: 31662
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Gm13318, Gm13364, Diet1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Vamp9
Name: vesicle-associated membrane protein 9
Synonyms: Gm35911
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 102639650
VEGA: 5
Homologene: 140982
Ankrd31
Name: ankyrin repeat domain 31
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 625662
Homologene: 110355
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 60,489,594 bp (GRCm38)
  • C to A, chromosome 1 at 66,695,590 bp (GRCm38)
  • A to G, chromosome 1 at 67,180,152 bp (GRCm38)
  • A to G, chromosome 1 at 74,569,857 bp (GRCm38)
  • A to T, chromosome 1 at 74,905,051 bp (GRCm38)
  • G to A, chromosome 1 at 139,480,994 bp (GRCm38)
  • T to A, chromosome 1 at 170,961,088 bp (GRCm38)
  • T to C, chromosome 2 at 15,752,849 bp (GRCm38)
  • G to A, chromosome 2 at 15,797,726 bp (GRCm38)
  • A to T, chromosome 2 at 20,865,342 bp (GRCm38)
  • T to A, chromosome 2 at 26,276,102 bp (GRCm38)
  • A to T, chromosome 2 at 26,914,796 bp (GRCm38)
  • T to A, chromosome 2 at 75,976,468 bp (GRCm38)
  • A to T, chromosome 2 at 86,314,834 bp (GRCm38)
  • A to C, chromosome 2 at 90,149,476 bp (GRCm38)
  • T to C, chromosome 2 at 117,249,769 bp (GRCm38)
  • T to A, chromosome 2 at 158,473,152 bp (GRCm38)
  • T to C, chromosome 3 at 51,396,481 bp (GRCm38)
  • T to C, chromosome 3 at 95,889,770 bp (GRCm38)
  • T to C, chromosome 4 at 47,016,789 bp (GRCm38)
  • A to G, chromosome 4 at 120,515,079 bp (GRCm38)
  • A to G, chromosome 4 at 132,334,763 bp (GRCm38)
  • G to T, chromosome 4 at 140,580,925 bp (GRCm38)
  • T to A, chromosome 5 at 14,712,438 bp (GRCm38)
  • G to T, chromosome 5 at 20,466,178 bp (GRCm38)
  • T to A, chromosome 5 at 65,274,431 bp (GRCm38)
  • C to T, chromosome 5 at 99,923,093 bp (GRCm38)
  • A to T, chromosome 6 at 8,667,288 bp (GRCm38)
  • A to G, chromosome 6 at 82,554,872 bp (GRCm38)
  • T to C, chromosome 6 at 97,178,905 bp (GRCm38)
  • A to G, chromosome 6 at 104,804,347 bp (GRCm38)
  • T to C, chromosome 6 at 123,235,573 bp (GRCm38)
  • C to A, chromosome 6 at 129,906,723 bp (GRCm38)
  • T to C, chromosome 6 at 142,374,891 bp (GRCm38)
  • C to A, chromosome 6 at 146,618,543 bp (GRCm38)
  • T to C, chromosome 7 at 58,658,591 bp (GRCm38)
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,923 bp (GRCm38)
  • C to T, chromosome 7 at 141,808,694 bp (GRCm38)
  • C to A, chromosome 8 at 22,175,883 bp (GRCm38)
  • A to T, chromosome 8 at 40,754,449 bp (GRCm38)
  • A to G, chromosome 8 at 45,085,575 bp (GRCm38)
  • T to C, chromosome 8 at 57,958,401 bp (GRCm38)
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp (GRCm38)
  • T to A, chromosome 8 at 69,706,591 bp (GRCm38)
  • G to T, chromosome 8 at 116,889,811 bp (GRCm38)
  • G to A, chromosome 9 at 105,783,860 bp (GRCm38)
  • T to C, chromosome 9 at 106,483,641 bp (GRCm38)
  • A to G, chromosome 10 at 18,784,581 bp (GRCm38)
  • T to C, chromosome 10 at 110,000,003 bp (GRCm38)
  • C to T, chromosome 10 at 110,784,681 bp (GRCm38)
  • A to G, chromosome 11 at 9,038,281 bp (GRCm38)
  • G to T, chromosome 11 at 16,887,155 bp (GRCm38)
  • T to C, chromosome 11 at 36,221,459 bp (GRCm38)
  • C to A, chromosome 11 at 82,960,059 bp (GRCm38)
  • T to C, chromosome 12 at 30,940,421 bp (GRCm38)
  • AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA, chromosome 12 at 51,887,919 bp (GRCm38)
  • A to G, chromosome 12 at 76,020,501 bp (GRCm38)
  • A to T, chromosome 12 at 76,095,070 bp (GRCm38)
  • A to G, chromosome 13 at 23,901,927 bp (GRCm38)
  • G to A, chromosome 13 at 85,202,402 bp (GRCm38)
  • A to T, chromosome 13 at 96,780,334 bp (GRCm38)
  • T to C, chromosome 13 at 96,780,338 bp (GRCm38)
  • A to T, chromosome 14 at 24,296,792 bp (GRCm38)
  • A to G, chromosome 14 at 55,596,152 bp (GRCm38)
  • T to A, chromosome 15 at 85,818,219 bp (GRCm38)
  • T to C, chromosome 15 at 98,256,942 bp (GRCm38)
  • T to C, chromosome 16 at 11,984,659 bp (GRCm38)
  • C to A, chromosome 16 at 29,314,520 bp (GRCm38)
  • G to A, chromosome 17 at 23,607,645 bp (GRCm38)
  • A to G, chromosome 17 at 23,676,517 bp (GRCm38)
  • G to A, chromosome 17 at 34,183,104 bp (GRCm38)
  • A to T, chromosome 17 at 35,321,373 bp (GRCm38)
  • G to T, chromosome 18 at 61,818,996 bp (GRCm38)
  • T to C, chromosome 19 at 5,645,340 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9454 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069257-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.