Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9455Btlr/Mmmh
Stock Number:
069258-MU
Citation ID:
RRID:MMRRC_069258-MU
Other Names:
R9455 (G1)
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Frrs1
Name: ferric-chelate reductase 1
Synonyms: Sdfr2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20321
Homologene: 40653
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Sin3b
Name: transcriptional regulator, SIN3B (yeast)
Synonyms: 2810430C10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20467
Homologene: 81810
Kdm2b
Name: lysine (K)-specific demethylase 2B
Synonyms: Cxxc2, Jhdm1b, Fbxl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 30841
Homologene: 13069
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 32,546,826 bp (GRCm38)
  • T to C, chromosome 1 at 40,629,452 bp (GRCm38)
  • T to C, chromosome 1 at 59,180,137 bp (GRCm38)
  • T to A, chromosome 1 at 71,607,953 bp (GRCm38)
  • A to T, chromosome 1 at 162,320,955 bp (GRCm38)
  • G to T, chromosome 1 at 163,954,152 bp (GRCm38)
  • A to T, chromosome 1 at 164,066,649 bp (GRCm38)
  • G to A, chromosome 1 at 195,062,396 bp (GRCm38)
  • A to G, chromosome 2 at 76,918,990 bp (GRCm38)
  • G to T, chromosome 2 at 160,895,339 bp (GRCm38)
  • A to C, chromosome 2 at 180,473,577 bp (GRCm38)
  • T to C, chromosome 3 at 38,891,263 bp (GRCm38)
  • T to A, chromosome 3 at 87,759,181 bp (GRCm38)
  • C to T, chromosome 3 at 103,836,053 bp (GRCm38)
  • T to A, chromosome 3 at 116,902,323 bp (GRCm38)
  • A to T, chromosome 3 at 121,734,217 bp (GRCm38)
  • T to A, chromosome 3 at 144,823,262 bp (GRCm38)
  • A to G, chromosome 4 at 8,752,061 bp (GRCm38)
  • T to C, chromosome 4 at 32,643,924 bp (GRCm38)
  • T to A, chromosome 5 at 53,131,815 bp (GRCm38)
  • T to C, chromosome 5 at 122,961,474 bp (GRCm38)
  • T to A, chromosome 6 at 52,766,044 bp (GRCm38)
  • A to G, chromosome 7 at 24,531,792 bp (GRCm38)
  • A to T, chromosome 7 at 46,913,403 bp (GRCm38)
  • T to A, chromosome 7 at 47,189,219 bp (GRCm38)
  • C to T, chromosome 7 at 62,348,589 bp (GRCm38)
  • G to T, chromosome 7 at 103,906,993 bp (GRCm38)
  • T to C, chromosome 7 at 128,252,837 bp (GRCm38)
  • C to G, chromosome 8 at 4,243,957 bp (GRCm38)
  • T to A, chromosome 8 at 15,106,293 bp (GRCm38)
  • C to T, chromosome 8 at 27,551,366 bp (GRCm38)
  • G to T, chromosome 8 at 72,724,053 bp (GRCm38)
  • A to T, chromosome 9 at 15,333,750 bp (GRCm38)
  • A to G, chromosome 9 at 108,111,332 bp (GRCm38)
  • A to T, chromosome 9 at 109,274,499 bp (GRCm38)
  • A to T, chromosome 9 at 120,051,593 bp (GRCm38)
  • T to C, chromosome 10 at 13,182,373 bp (GRCm38)
  • T to C, chromosome 11 at 9,403,897 bp (GRCm38)
  • G to T, chromosome 11 at 54,319,926 bp (GRCm38)
  • A to T, chromosome 11 at 79,020,776 bp (GRCm38)
  • T to C, chromosome 11 at 87,770,533 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • T to C, chromosome 12 at 82,387,625 bp (GRCm38)
  • A to T, chromosome 13 at 89,689,333 bp (GRCm38)
  • G to A, chromosome 14 at 27,486,915 bp (GRCm38)
  • G to A, chromosome 14 at 79,062,675 bp (GRCm38)
  • A to T, chromosome 14 at 100,109,790 bp (GRCm38)
  • T to A, chromosome 15 at 75,269,799 bp (GRCm38)
  • C to A, chromosome 15 at 75,888,056 bp (GRCm38)
  • G to T, chromosome 16 at 18,429,865 bp (GRCm38)
  • T to G, chromosome 16 at 32,486,195 bp (GRCm38)
  • C to T, chromosome 16 at 85,870,129 bp (GRCm38)
  • C to A, chromosome 17 at 7,352,293 bp (GRCm38)
  • T to C, chromosome 17 at 28,644,614 bp (GRCm38)
  • T to C, chromosome 17 at 43,494,976 bp (GRCm38)
  • T to C, chromosome 17 at 71,274,490 bp (GRCm38)
  • T to A, chromosome 18 at 84,672,121 bp (GRCm38)
  • T to C, chromosome 19 at 4,143,845 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9455 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069258-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.