Strain Name:
C57BL/6J-MtgxR9455Btlr/Mmmh
Stock Number:
069258-MU
Citation ID:
RRID:MMRRC_069258-MU
Other Names:
R9455 (G1)
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: Todo, Gena 52, GENA 60, Dz, Cycn, Cyn, Obt, Mt, Whi, GENA 47, A730019I05Rik, Lda, Flo, Edy, WBE1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Fn1
Name: fibronectin 1
Synonyms: Fn, Fn-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Vcan
Name: versican
Synonyms: hdf, DPEAAE, heart defect, 5430420N07Rik, PG-M, Cspg2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Frrs1
Name: ferric-chelate reductase 1
Synonyms: Sdfr2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20321
Homologene: 40653
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Sin3b
Name: transcriptional regulator, SIN3B (yeast)
Synonyms: 2810430C10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20467
Homologene: 81810
Kdm2b
Name: lysine (K)-specific demethylase 2B
Synonyms: Fbxl10, Cxxc2, Jhdm1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 30841
Homologene: 13069
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: Als2cr6, 3222402C23Rik, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Klf12
Name: Kruppel-like transcription factor 12
Synonyms: B130052C06Rik, AP-2rep, D530033K05Rik, 2700063E05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16597
VEGA: 14
HGNC: HGNC:6346
Homologene: 21417
Tsg101
Name: tumor susceptibility gene 101
Synonyms: CC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22088
Homologene: 4584
Tax1bp1
Name: Tax1 (human T cell leukemia virus type I) binding protein 1
Synonyms: D6Ertd404e, 1200003J11Rik, 1700069J21Rik, T6BP, TXBP151, D6Ertd772e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52440
Homologene: 4395
Casp8ap2
Name: caspase 8 associated protein 2
Synonyms: D4Ertd659e, FLASH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26885
HGNC: HGNC:1510
Homologene: 8066
Firrm
Name: FIGNL1 interacting regulator of recombination and mitosis
Synonyms: FLIP, BC055324
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381306
Homologene: 10058
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110895
Homologene: 72232
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Cx3cr1
Name: C-X3-C motif chemokine receptor 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13051
VEGA: 9
HGNC: HGNC:2558
Homologene: 20350
Gpr152
Name: G protein-coupled receptor 152
Synonyms: LOC269053, A930009H15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269053
VEGA: 19
Homologene: 35474
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Sell
Name: selectin, lymphocyte
Synonyms: CD62L, LECAM-1, Ly-22, Lyam1, Lnhr, Lyam-1, L-selectin, Ly-m22
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20343
Homologene: 539
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Emilin2
Name: elastin microfibril interfacer 2
Synonyms: FOAP-10, basilin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 246707
VEGA: 17
Homologene: 36483
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
F3
Name: coagulation factor III
Synonyms: tissue factor, TF, CD142, Cf3, Cf-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14066
HGNC: HGNC:3541
Homologene: 1511
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: Jedi-1, 3110045G13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73182
Homologene: 12492
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 1300010F03Rik, 4932416F07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: Fbxo12, Fbx12, E330009N23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50757
Homologene: 110776
Dnm3
Name: dynamin 3
Synonyms: 9630020E24Rik, B230343F03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 103967
Homologene: 22906
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Myom2
Name: myomesin 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Ksr1
Name: kinase suppressor of ras 1
Synonyms: B-KSR1, D11Bhm183e, D11Bhm184e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
Slc51a
Name: solute carrier family 51, alpha subunit
Synonyms: OSTalpha, Osta, D630035O19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106407
Homologene: 44941
Semp2l1
Name: SUMO/sentrin specific peptidase 2-like 1
Synonyms: Gm5415
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 408191
Homologene: 130042
Tgfb1i1
Name: transforming growth factor beta 1 induced transcript 1
Synonyms: TSC-5, ARA55, hic-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21804
Homologene: 7572
Mep1a
Name: meprin 1 alpha
Synonyms: meprin A alpha-subunit, Mep-1a, meprin alpha, Mep1, Mep-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17287
HGNC: HGNC:7015
Homologene: 31323
Clca3b
Name: chloride channel accessory 3B
Synonyms: Clca4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229927
HGNC: HGNC:2017
Homologene: 135610
Cd46
Name: CD46 antigen, complement regulatory protein
Synonyms: CD46, Mcp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17221
HGNC: HGNC:6953
Homologene: 7832
Ltv1
Name: LTV1 ribosome biogenesis factor
Synonyms: 2610020N02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353258
VEGA: 10
Homologene: 6338
Ccdc66
Name: coiled-coil domain containing 66
Synonyms: E230015L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 320234
VEGA: 14
Homologene: 35309
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: 9530092O11Rik, ADAM-TS5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Ly6f
Name: lymphocyte antigen 6 family member F
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17071
Homologene: 113718
Acsl6
Name: acyl-CoA synthetase long-chain family member 6
Synonyms: A330035H04Rik, Facl6, Lacsl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216739
Homologene: 100939
Txnrd2
Name: thioredoxin reductase 2
Synonyms: ESTM573010, TGR, TR3, TR beta
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26462
Homologene: 4701
Bcl2l15
Name: BCLl2-like 15
Synonyms: LOC229672, Bfk
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229672
Homologene: 19060
Or51b6
Name: olfactory receptor family 51 subfamily B member 6
Synonyms: GA_x6K02T2PBJ9-6634906-6633983, 5'[b]3, Olfr65, MOR1-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18365
Homologene: 66459
Slc26a8
Name: solute carrier family 26, member 8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224661
Homologene: 27095
Cndp2
Name: CNDP dipeptidase 2
Synonyms: Dip-2, Pep1, 0610010E05Rik, Cn2, Pep-1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66054
VEGA: 18
Homologene: 10085
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Mrgpra6
Name: MAS-related GPR, member A6
Synonyms: MrgA6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381886
Map2k7
Name: mitogen-activated protein kinase kinase 7
Synonyms: 5930412N11Rik, MKK7, sek2, MAP kinase kinase 7, Jnkk2, Prkmk7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26400
HGNC: HGNC:6847
Homologene: 56548
Ndn
Name: necdin, MAGE family member
Synonyms: Peg6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17984
HGNC: HGNC:7675
Homologene: 20559
Slco4a1
Name: solute carrier organic anion transporter family, member 4a1
Synonyms: OATP-E, Slc21a12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108115
Homologene: 9482
Ttll2
Name: tubulin tyrosine ligase-like family, member 2
Synonyms: EG625850
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100216474
VEGA: 17
Homologene: 12917
Irgq
Name: immunity-related GTPase family, Q
Synonyms: FKSG27
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210146
Homologene: 17696
Mroh6
Name: maestro heat-like repeat family member 6
Synonyms: Gm19570
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223645
Homologene: 90414
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 32,546,826 bp (GRCm38)
  • T to C, chromosome 1 at 40,629,452 bp (GRCm38)
  • T to C, chromosome 1 at 59,180,137 bp (GRCm38)
  • T to A, chromosome 1 at 71,607,953 bp (GRCm38)
  • A to T, chromosome 1 at 162,320,955 bp (GRCm38)
  • G to T, chromosome 1 at 163,954,152 bp (GRCm38)
  • A to T, chromosome 1 at 164,066,649 bp (GRCm38)
  • G to A, chromosome 1 at 195,062,396 bp (GRCm38)
  • A to G, chromosome 2 at 76,918,990 bp (GRCm38)
  • G to T, chromosome 2 at 160,895,339 bp (GRCm38)
  • A to C, chromosome 2 at 180,473,577 bp (GRCm38)
  • T to C, chromosome 3 at 38,891,263 bp (GRCm38)
  • T to A, chromosome 3 at 87,759,181 bp (GRCm38)
  • C to T, chromosome 3 at 103,836,053 bp (GRCm38)
  • T to A, chromosome 3 at 116,902,323 bp (GRCm38)
  • A to T, chromosome 3 at 121,734,217 bp (GRCm38)
  • T to A, chromosome 3 at 144,823,262 bp (GRCm38)
  • A to G, chromosome 4 at 8,752,061 bp (GRCm38)
  • T to C, chromosome 4 at 32,643,924 bp (GRCm38)
  • T to A, chromosome 5 at 53,131,815 bp (GRCm38)
  • T to C, chromosome 5 at 122,961,474 bp (GRCm38)
  • T to A, chromosome 6 at 52,766,044 bp (GRCm38)
  • A to G, chromosome 7 at 24,531,792 bp (GRCm38)
  • A to T, chromosome 7 at 46,913,403 bp (GRCm38)
  • T to A, chromosome 7 at 47,189,219 bp (GRCm38)
  • C to T, chromosome 7 at 62,348,589 bp (GRCm38)
  • G to T, chromosome 7 at 103,906,993 bp (GRCm38)
  • T to C, chromosome 7 at 128,252,837 bp (GRCm38)
  • C to G, chromosome 8 at 4,243,957 bp (GRCm38)
  • T to A, chromosome 8 at 15,106,293 bp (GRCm38)
  • C to T, chromosome 8 at 27,551,366 bp (GRCm38)
  • G to T, chromosome 8 at 72,724,053 bp (GRCm38)
  • A to T, chromosome 9 at 15,333,750 bp (GRCm38)
  • A to G, chromosome 9 at 108,111,332 bp (GRCm38)
  • A to T, chromosome 9 at 109,274,499 bp (GRCm38)
  • A to T, chromosome 9 at 120,051,593 bp (GRCm38)
  • T to C, chromosome 10 at 13,182,373 bp (GRCm38)
  • T to C, chromosome 11 at 9,403,897 bp (GRCm38)
  • G to T, chromosome 11 at 54,319,926 bp (GRCm38)
  • A to T, chromosome 11 at 79,020,776 bp (GRCm38)
  • T to C, chromosome 11 at 87,770,533 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • T to C, chromosome 12 at 82,387,625 bp (GRCm38)
  • A to T, chromosome 13 at 89,689,333 bp (GRCm38)
  • G to A, chromosome 14 at 27,486,915 bp (GRCm38)
  • G to A, chromosome 14 at 79,062,675 bp (GRCm38)
  • A to T, chromosome 14 at 100,109,790 bp (GRCm38)
  • T to A, chromosome 15 at 75,269,799 bp (GRCm38)
  • C to A, chromosome 15 at 75,888,056 bp (GRCm38)
  • G to T, chromosome 16 at 18,429,865 bp (GRCm38)
  • T to G, chromosome 16 at 32,486,195 bp (GRCm38)
  • C to T, chromosome 16 at 85,870,129 bp (GRCm38)
  • C to A, chromosome 17 at 7,352,293 bp (GRCm38)
  • T to C, chromosome 17 at 28,644,614 bp (GRCm38)
  • T to C, chromosome 17 at 43,494,976 bp (GRCm38)
  • T to C, chromosome 17 at 71,274,490 bp (GRCm38)
  • T to A, chromosome 18 at 84,672,121 bp (GRCm38)
  • T to C, chromosome 19 at 4,143,845 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9455 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069258-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.