Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9496Btlr/Mmmh
Stock Number:
069299-MU
Citation ID:
RRID:MMRRC_069299-MU
Other Names:
R9496 (G1)
Major Collection:

Strain Information

Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 4,828,590 bp (GRCm38)
  • C to T, chromosome 1 at 75,490,840 bp (GRCm38)
  • T to A, chromosome 1 at 87,929,742 bp (GRCm38)
  • A to G, chromosome 1 at 118,836,695 bp (GRCm38)
  • T to C, chromosome 1 at 150,704,220 bp (GRCm38)
  • A to C, chromosome 1 at 171,051,817 bp (GRCm38)
  • A to T, chromosome 2 at 10,102,173 bp (GRCm38)
  • A to T, chromosome 2 at 63,978,909 bp (GRCm38)
  • A to G, chromosome 2 at 65,482,149 bp (GRCm38)
  • A to T, chromosome 2 at 82,962,718 bp (GRCm38)
  • A to C, chromosome 2 at 129,270,675 bp (GRCm38)
  • C to T, chromosome 4 at 101,020,548 bp (GRCm38)
  • T to C, chromosome 4 at 130,719,353 bp (GRCm38)
  • A to T, chromosome 5 at 72,528,159 bp (GRCm38)
  • T to G, chromosome 5 at 73,510,929 bp (GRCm38)
  • A to G, chromosome 5 at 109,676,058 bp (GRCm38)
  • T to C, chromosome 5 at 110,707,987 bp (GRCm38)
  • C to T, chromosome 5 at 113,845,276 bp (GRCm38)
  • C to T, chromosome 5 at 137,484,139 bp (GRCm38)
  • A to G, chromosome 6 at 72,325,776 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to T, chromosome 7 at 24,181,038 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • T to C, chromosome 7 at 46,241,081 bp (GRCm38)
  • G to A, chromosome 7 at 105,555,995 bp (GRCm38)
  • A to G, chromosome 7 at 107,754,747 bp (GRCm38)
  • A to T, chromosome 9 at 109,568,223 bp (GRCm38)
  • A to T, chromosome 10 at 13,168,796 bp (GRCm38)
  • T to C, chromosome 10 at 18,129,137 bp (GRCm38)
  • C to A, chromosome 11 at 8,833,773 bp (GRCm38)
  • T to C, chromosome 11 at 74,816,870 bp (GRCm38)
  • A to G, chromosome 11 at 94,465,885 bp (GRCm38)
  • GCTGCTGCCAGCCCTGCTGCCAGCCC to GCTGCTGCCAGCCCTGCTGCCAGCCCTGCTGCCAGCCC, chromosome 11 at 99,858,218 bp (GRCm38)
  • C to T, chromosome 11 at 102,467,803 bp (GRCm38)
  • A to G, chromosome 11 at 120,091,531 bp (GRCm38)
  • T to C, chromosome 12 at 70,055,988 bp (GRCm38)
  • T to C, chromosome 13 at 112,952,926 bp (GRCm38)
  • C to A, chromosome 14 at 32,426,162 bp (GRCm38)
  • T to C, chromosome 14 at 35,569,614 bp (GRCm38)
  • T to C, chromosome 14 at 79,020,682 bp (GRCm38)
  • T to C, chromosome 15 at 76,374,656 bp (GRCm38)
  • T to G, chromosome 15 at 95,296,216 bp (GRCm38)
  • C to T, chromosome 15 at 102,711,441 bp (GRCm38)
  • T to G, chromosome 16 at 10,480,145 bp (GRCm38)
  • G to A, chromosome 16 at 14,230,752 bp (GRCm38)
  • A to G, chromosome 16 at 58,450,801 bp (GRCm38)
  • T to A, chromosome 17 at 18,928,965 bp (GRCm38)
  • A to T, chromosome 17 at 25,836,397 bp (GRCm38)
  • A to G, chromosome 17 at 28,821,479 bp (GRCm38)
  • T to A, chromosome 17 at 79,667,996 bp (GRCm38)
  • A to T, chromosome 19 at 6,259,992 bp (GRCm38)
  • A to G, chromosome 19 at 10,216,476 bp (GRCm38)
  • G to T, chromosome 19 at 58,975,025 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9496 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069299-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.