Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9496Btlr/Mmmh
Stock Number:
069299-MU
Citation ID:
RRID:MMRRC_069299-MU
Other Names:
R9496 (G1)
Major Collection:

Strain Information

Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Coro1c
Name: coronin, actin binding protein 1C
Synonyms: coronin 3, CRN2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23790
HGNC: HGNC:2254
Homologene: 56537
Lypla1
Name: lysophospholipase 1
Synonyms: Pla1a, Gm39587
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18777
HGNC: HGNC:6737
Homologene: 100781
Ckap2l
Name: cytoskeleton associated protein 2-like
Synonyms: 2010016H04Rik, 2610318C08Rik, Radmis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70466
Homologene: 51866
Dgkd
Name: diacylglycerol kinase, delta
Synonyms: DGKdelta, dgkd-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227333
HGNC: HGNC:2851
Homologene: 100054
Calcoco1
Name: calcium binding and coiled coil domain 1
Synonyms: 1810009B06Rik, CoCoA, Gcap11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67488
Homologene: 10845
Usp39
Name: ubiquitin specific peptidase 39
Synonyms: D6Wsu157e, CGI-21, SAD1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28035
Homologene: 13183
Mettl16
Name: methyltransferase 16, N6-methyladenosine
Synonyms: 2610100D03Rik, A830095F14Rik, 2810013M15Rik, Mett10d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67493
Homologene: 34653
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Tepsin
Name: TEPSIN, adaptor related protein complex 4 accessory protein
Synonyms: 2410002I01Rik, Enthd2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78777
Homologene: 35359
Dhx29
Name: DExH-box helicase 29
Synonyms: E130202M19Rik, DEAH (Asp-Glu-Ala-His) box polypeptide 29
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218629
VEGA: 13
Homologene: 10387
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Fign
Name: fidgetin
Synonyms: Fgn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60344
Homologene: 5813
Shtn1
Name: shootin 1
Synonyms: shootin1, 4930506M07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71653
VEGA: 19
Homologene: 41249
Ciita
Name: class II transactivator
Synonyms: C2ta, Gm9475
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12265
VEGA: 16
HGNC: HGNC:7067
Homologene: 207
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Rmdn2
Name: regulator of microtubule dynamics 2
Synonyms: Fam82a1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381110
VEGA: 17
Homologene: 71930
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Nell2
Name: NEL-like 2
Synonyms: mel91, A330108N19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54003
VEGA: 15
HGNC: HGNC:7751
Homologene: 4488
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Dcbld2
Name: discoidin, CUB and LCCL domain containing 2
Synonyms: 1700055P21Rik, Esdn, CLCP1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73379
Homologene: 12499
Itih2
Name: inter-alpha trypsin inhibitor, heavy chain 2
Synonyms: Intin2, Itih-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16425
HGNC: HGNC:6167
Homologene: 1668
Itga2b
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, GpIIb, alphaIIb, CD41, GP IIb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
Myrf
Name: myelin regulatory factor
Synonyms: LOC225908, LOC386531, Gm98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Fbxw15
Name: F-box and WD-40 domain protein 15
Synonyms: Fbxo12J
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382105
Homologene: 110776
Zfp1007
Name: zinc finger protein 1007
Synonyms: ENSMUSG00000072763, 5430403G16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77200
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: TCF9, LOC381696, D430033A06Rik, 1700012H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100978
Homologene: 26752
Vmn2r97
Name: vomeronasal 2, receptor 97
Synonyms: EG627367
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627367
Homologene: 115024
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Gm10577
Name: predicted gene 10577
Type: Gene
Species: Mouse
Chromosome: 4
Cyb5r2
Name: cytochrome b5 reductase 2
Synonyms: D630003K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320635
Homologene: 6182
Smpd1
Name: sphingomyelin phosphodiesterase 1, acid lysosomal
Synonyms: A-SMase, aSMase, ASM, acid sphingomyelinase, Zn-SMase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20597
Homologene: 457
Dcun1d4
Name: defective in cullin neddylation 1 domain containing 4
Synonyms: DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100737
Homologene: 22867
Tssk5
Name: testis-specific serine kinase 5
Synonyms: 1700091F14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73542
VEGA: 15
Homologene: 18832
Zc2hc1b
Name: zinc finger, C2HC-type containing 1B
Synonyms: 4930519B02Rik, Fam164b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75122
VEGA: 10
Homologene: 77965
Rhbdl1
Name: rhomboid like 1
Synonyms: Rhbdl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214951
Homologene: 2946
Fcgr3
Name: Fc receptor, IgG, low affinity III
Synonyms: Fcg receptor III, CD16, FcgammaRIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14131
HGNC: HGNC:3616
Homologene: 47936
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 4,828,590 bp (GRCm38)
  • C to T, chromosome 1 at 75,490,840 bp (GRCm38)
  • T to A, chromosome 1 at 87,929,742 bp (GRCm38)
  • A to G, chromosome 1 at 118,836,695 bp (GRCm38)
  • T to C, chromosome 1 at 150,704,220 bp (GRCm38)
  • A to C, chromosome 1 at 171,051,817 bp (GRCm38)
  • A to T, chromosome 2 at 10,102,173 bp (GRCm38)
  • A to T, chromosome 2 at 63,978,909 bp (GRCm38)
  • A to G, chromosome 2 at 65,482,149 bp (GRCm38)
  • A to T, chromosome 2 at 82,962,718 bp (GRCm38)
  • A to C, chromosome 2 at 129,270,675 bp (GRCm38)
  • C to T, chromosome 4 at 101,020,548 bp (GRCm38)
  • T to C, chromosome 4 at 130,719,353 bp (GRCm38)
  • A to T, chromosome 5 at 72,528,159 bp (GRCm38)
  • T to G, chromosome 5 at 73,510,929 bp (GRCm38)
  • A to G, chromosome 5 at 109,676,058 bp (GRCm38)
  • T to C, chromosome 5 at 110,707,987 bp (GRCm38)
  • C to T, chromosome 5 at 113,845,276 bp (GRCm38)
  • C to T, chromosome 5 at 137,484,139 bp (GRCm38)
  • A to G, chromosome 6 at 72,325,776 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to T, chromosome 7 at 24,181,038 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • T to C, chromosome 7 at 46,241,081 bp (GRCm38)
  • G to A, chromosome 7 at 105,555,995 bp (GRCm38)
  • A to G, chromosome 7 at 107,754,747 bp (GRCm38)
  • A to T, chromosome 9 at 109,568,223 bp (GRCm38)
  • A to T, chromosome 10 at 13,168,796 bp (GRCm38)
  • T to C, chromosome 10 at 18,129,137 bp (GRCm38)
  • C to A, chromosome 11 at 8,833,773 bp (GRCm38)
  • T to C, chromosome 11 at 74,816,870 bp (GRCm38)
  • A to G, chromosome 11 at 94,465,885 bp (GRCm38)
  • GCTGCTGCCAGCCCTGCTGCCAGCCC to GCTGCTGCCAGCCCTGCTGCCAGCCCTGCTGCCAGCCC, chromosome 11 at 99,858,218 bp (GRCm38)
  • C to T, chromosome 11 at 102,467,803 bp (GRCm38)
  • A to G, chromosome 11 at 120,091,531 bp (GRCm38)
  • T to C, chromosome 12 at 70,055,988 bp (GRCm38)
  • T to C, chromosome 13 at 112,952,926 bp (GRCm38)
  • C to A, chromosome 14 at 32,426,162 bp (GRCm38)
  • T to C, chromosome 14 at 35,569,614 bp (GRCm38)
  • T to C, chromosome 14 at 79,020,682 bp (GRCm38)
  • T to C, chromosome 15 at 76,374,656 bp (GRCm38)
  • T to G, chromosome 15 at 95,296,216 bp (GRCm38)
  • C to T, chromosome 15 at 102,711,441 bp (GRCm38)
  • T to G, chromosome 16 at 10,480,145 bp (GRCm38)
  • G to A, chromosome 16 at 14,230,752 bp (GRCm38)
  • A to G, chromosome 16 at 58,450,801 bp (GRCm38)
  • T to A, chromosome 17 at 18,928,965 bp (GRCm38)
  • A to T, chromosome 17 at 25,836,397 bp (GRCm38)
  • A to G, chromosome 17 at 28,821,479 bp (GRCm38)
  • T to A, chromosome 17 at 79,667,996 bp (GRCm38)
  • A to T, chromosome 19 at 6,259,992 bp (GRCm38)
  • A to G, chromosome 19 at 10,216,476 bp (GRCm38)
  • G to T, chromosome 19 at 58,975,025 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9496 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069299-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.