Strain Name:
C57BL/6J-MtgxR9498Btlr/Mmmh
Stock Number:
069301-MU
Citation ID:
RRID:MMRRC_069301-MU
Other Names:
R9498 (G1)
Major Collection:

Strain Information

Cmtm5
Name: CKLF-like MARVEL transmembrane domain containing 5
Synonyms: 1500005P16Rik, 2900052H21Rik, Cklfsf5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67272
VEGA: 14
Homologene: 16322
Areg
Name: amphiregulin
Synonyms: Mcub, AR, Sdgf
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11839
HGNC: HGNC:651
Homologene: 1252
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, Ncam-2, Ocam, R4B12 antigen
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Pex7
Name: peroxisomal biogenesis factor 7
Synonyms: peroxisome biogenesis factor 7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18634
HGNC: HGNC:8860
Homologene: 242
Esco2
Name: establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms: 2410004I17Rik, D030072L07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71988
Homologene: 12432
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60611
Homologene: 10187
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, C2PA-RGS3, RGS3S, C2pa, PDZ-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Pde1b
Name: phosphodiesterase 1B, Ca2+-calmodulin dependent
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18574
VEGA: 15
HGNC: HGNC:8775
Homologene: 37370
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Gluralpha4, Glur-4, Glur4, spkw1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Tars2
Name: threonyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms: 2610024N01Rik, Tarsl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71807
Homologene: 23520
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: B130010C12Rik, GCP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: Nedd4-2, Nedd4b, 1300012C07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Syt13
Name: synaptotagmin XIII
Synonyms: 5730409J20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80976
Homologene: 10823
Pcbp2
Name: poly(rC) binding protein 2
Synonyms: alphaCP-2, Hnrpx
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18521
VEGA: 15
HGNC: HGNC:8648
Homologene: 74536
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Zfp141
Name: zinc finger protein 141
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434178
Alb
Name: albumin
Synonyms: Alb1, Alb-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11657
HGNC: HGNC:399
Homologene: 405
Srsf6
Name: serine and arginine-rich splicing factor 6
Synonyms: Sfrs6, 1210001E11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67996
Homologene: 110783
Trappc6b
Name: trafficking protein particle complex 6B
Synonyms: 5830498C14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78232
VEGA: 12
Homologene: 42466
Rbm14
Name: RNA binding motif protein 14
Synonyms: 1300007E16Rik, p16, PSP2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56275
Homologene: 4614
Hrob
Name: homologous recombination factor with OB-fold
Synonyms: BC030867
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217216
Homologene: 69368
Dsg3
Name: desmoglein 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13512
VEGA: 18
HGNC: HGNC:3050
Homologene: 55513
Rfx8
Name: regulatory factor X 8
Synonyms: 4933400N17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 619289
Homologene: 82436
Pkp1
Name: plakophilin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18772
HGNC: HGNC:9023
Homologene: 253
Aoc1l3
Name: amine oxidase copper containing 1-like 3
Synonyms: Svs1, SVS I
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243377
HGNC: HGNC:80
Homologene: 18250
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Ampd3
Name: adenosine monophosphate deaminase 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11717
HGNC: HGNC:470
Homologene: 408
Cdh7
Name: cadherin 7, type 2
Synonyms: 9330156F07Rik, CDH7L1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Arhgef11
Name: Rho guanine nucleotide exchange factor 11
Synonyms: PDZ-RhoGEF, Prg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213498
Homologene: 11409
Ednra
Name: endothelin receptor type A
Synonyms: AEA001, ET-AR, Mhdaaea1, ETa, Gpcr10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13617
HGNC: HGNC:3179
Homologene: 1478
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 112417
Homologene: 137225
Myo15b
Name: myosin XVB
Synonyms: LOC217328, E330039G21Rik, LOC380737
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Abhd12b
Name: abhydrolase domain containing 12B
Synonyms: LOC328121
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100504285
Homologene: 128243
Nfic
Name: nuclear factor I/C
Synonyms: nuclear factor 1-C2, NF1-C, 1500041O16Rik, 1110019L22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18029
HGNC: HGNC:7786
Homologene: 4088
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Tubb1
Name: tubulin, beta 1 class VI
Synonyms: 2810484G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545486
Homologene: 69474
Tbc1d16
Name: TBC1 domain family, member 16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207592
Homologene: 10380
Nrxn1
Name: neurexin I
Synonyms: neurexin I alpha, 9330127H16Rik, neurexin I beta, A230068P09Rik, alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I alpha, 1700062G21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Slc29a4
Name: solute carrier family 29 (nucleoside transporters), member 4
Synonyms: ENT4, mPMAT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243328
Homologene: 71345
Vmn2r55
Name: vomeronasal 2, receptor 55
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042499
Homologene: 104040
B3glct
Name: beta-3-glucosyltransferase
Synonyms: B3galtl, LOC381694
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381694
Homologene: 14978
Plxnc1
Name: plexin C1
Synonyms: vespr, CD232, 2510048K12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Rasgrf1
Name: RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms: CDC25, Grfbeta, CDC25Mm, Grf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19417
HGNC: HGNC:9875
Homologene: 74972
Pcdhb1
Name: protocadherin beta 1
Synonyms: PcdhbA
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93872
HGNC: HGNC:8680
Homologene: 8348
Pcdhb15
Name: protocadherin beta 15
Synonyms: PcdhbO, Pcdhb7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93886
HGNC: HGNC:8692
Homologene: 32429
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98733
Plbd1
Name: phospholipase B domain containing 1
Synonyms: 1100001H23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66857
Homologene: 11745
Prr36
Name: proline rich 36
Synonyms: BC068157
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73072
Homologene: 136398
Cpa6
Name: carboxypeptidase A6
Synonyms: 9030616D13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329093
Homologene: 75130
Aadacl3
Name: arylacetamide deacetylase like 3
Synonyms: LOC230883
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230883
Homologene: 28426
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Zfp850
Name: zinc finger protein 850
Synonyms: C130069I09Rik, Gm4636
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043772
Tbc1d21
Name: TBC1 domain family, member 21
Synonyms: 1700095K08Rik, MgcRabGAP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74286
VEGA: 9
Homologene: 14033
Cdh22
Name: cadherin 22
Synonyms: PB-cadherin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104010
Homologene: 23148
Or8k17
Name: olfactory receptor family 8 subfamily K member 17
Synonyms: MOR187-2, Olfr1048, GA_x6K02T2Q125-47716657-47715716
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259016
Frmd3
Name: FERM domain containing 3
Synonyms: 4.1O, 9430066I12Rik, EPB41L4O, P410
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242506
Homologene: 16012
Ifi204
Name: interferon activated gene 204
Synonyms: p204
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15951
Homologene: 115929
Lgalsl
Name: galectin like
Synonyms: 1110067D22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216551
Homologene: 8581
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: HAI-2 related small protein, H2RSP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Casp7
Name: caspase 7
Synonyms: CMH-1, caspase-7, Mch3, ICE-IAP3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12369
VEGA: 19
HGNC: HGNC:1508
Homologene: 11168
Wfdc3
Name: WAP four-disulfide core domain 3
Synonyms: 1700015L13Rik, 1700127F16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71856
Homologene: 122221
Speer4a3
Name: spermatogenesis associated glutamate (E)-rich protein 4A3
Synonyms: Gm21671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862359
Homologene: 69402
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 10,409,321 bp (GRCm38)
  • T to C, chromosome 1 at 39,685,514 bp (GRCm38)
  • A to G, chromosome 1 at 46,214,404 bp (GRCm38)
  • C to T, chromosome 1 at 75,490,840 bp (GRCm38)
  • T to A, chromosome 1 at 90,785,928 bp (GRCm38)
  • A to G, chromosome 1 at 110,048,905 bp (GRCm38)
  • T to A, chromosome 1 at 135,890,082 bp (GRCm38)
  • T to C, chromosome 1 at 173,755,971 bp (GRCm38)
  • A to G, chromosome 2 at 86,236,494 bp (GRCm38)
  • A to T, chromosome 2 at 92,951,404 bp (GRCm38)
  • A to G, chromosome 2 at 162,932,089 bp (GRCm38)
  • G to A, chromosome 2 at 164,743,077 bp (GRCm38)
  • G to T, chromosome 2 at 165,112,570 bp (GRCm38)
  • A to G, chromosome 2 at 174,457,610 bp (GRCm38)
  • A to G, chromosome 3 at 87,733,177 bp (GRCm38)
  • A to T, chromosome 3 at 95,740,241 bp (GRCm38)
  • A to T, chromosome 4 at 62,657,175 bp (GRCm38)
  • G to A, chromosome 4 at 74,119,818 bp (GRCm38)
  • A to G, chromosome 4 at 144,456,419 bp (GRCm38)
  • AACT to A, chromosome 5 at 25,950,851 bp (GRCm38)
  • T to C, chromosome 5 at 87,254,385 bp (GRCm38)
  • T to C, chromosome 5 at 90,469,503 bp (GRCm38)
  • T to G, chromosome 5 at 91,146,694 bp (GRCm38)
  • T to A, chromosome 5 at 142,718,478 bp (GRCm38)
  • A to G, chromosome 5 at 149,750,429 bp (GRCm38)
  • AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC to AGGCCCAGCC, chromosome 6 at 48,988,018 bp (GRCm38)
  • A to G, chromosome 6 at 122,842,833 bp (GRCm38)
  • T to C, chromosome 6 at 136,612,246 bp (GRCm38)
  • A to G, chromosome 7 at 12,670,885 bp (GRCm38)
  • T to C, chromosome 7 at 27,989,850 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to A, chromosome 7 at 42,476,346 bp (GRCm38)
  • C to T, chromosome 7 at 55,813,485 bp (GRCm38)
  • T to A, chromosome 7 at 110,809,846 bp (GRCm38)
  • T to A, chromosome 8 at 4,213,291 bp (GRCm38)
  • A to T, chromosome 8 at 77,720,305 bp (GRCm38)
  • A to T, chromosome 9 at 4,503,560 bp (GRCm38)
  • A to G, chromosome 9 at 58,366,641 bp (GRCm38)
  • A to G, chromosome 9 at 59,827,183 bp (GRCm38)
  • A to T, chromosome 9 at 89,944,868 bp (GRCm38)
  • G to A, chromosome 10 at 19,887,113 bp (GRCm38)
  • T to C, chromosome 10 at 81,420,668 bp (GRCm38)
  • C to G, chromosome 10 at 94,813,142 bp (GRCm38)
  • T to A, chromosome 11 at 20,829,439 bp (GRCm38)
  • T to C, chromosome 11 at 65,848,373 bp (GRCm38)
  • T to C, chromosome 11 at 102,259,341 bp (GRCm38)
  • T to C, chromosome 11 at 110,086,548 bp (GRCm38)
  • A to G, chromosome 11 at 115,879,958 bp (GRCm38)
  • A to T, chromosome 11 at 119,157,855 bp (GRCm38)
  • A to G, chromosome 12 at 59,050,341 bp (GRCm38)
  • A to G, chromosome 12 at 70,163,463 bp (GRCm38)
  • T to A, chromosome 14 at 54,936,748 bp (GRCm38)
  • T to C, chromosome 14 at 65,831,303 bp (GRCm38)
  • G to A, chromosome 15 at 64,920,196 bp (GRCm38)
  • G to A, chromosome 15 at 102,498,506 bp (GRCm38)
  • A to T, chromosome 15 at 103,527,062 bp (GRCm38)
  • T to C, chromosome 16 at 81,512,999 bp (GRCm38)
  • T to C, chromosome 17 at 24,265,506 bp (GRCm38)
  • T to C, chromosome 17 at 90,589,969 bp (GRCm38)
  • A to C, chromosome 18 at 20,525,221 bp (GRCm38)
  • A to G, chromosome 18 at 37,265,463 bp (GRCm38)
  • A to T, chromosome 18 at 37,473,837 bp (GRCm38)
  • T to C, chromosome 18 at 65,161,652 bp (GRCm38)
  • A to G, chromosome 19 at 4,803,467 bp (GRCm38)
  • G to T, chromosome 19 at 10,254,854 bp (GRCm38)
  • T to A, chromosome 19 at 56,436,335 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9498 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069301-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.