Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9498Btlr/Mmmh
Stock Number:
069301-MU
Citation ID:
RRID:MMRRC_069301-MU
Other Names:
R9498 (G1)
Major Collection:

Strain Information

Cmtm5
Name: CKLF-like MARVEL transmembrane domain containing 5
Synonyms: 2900052H21Rik, 1500005P16Rik, Cklfsf5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67272
VEGA: 14
Homologene: 16322
Areg
Name: amphiregulin
Synonyms: AR, Sdgf, Mcub
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11839
HGNC: HGNC:651
Homologene: 1252
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Pex7
Name: peroxisomal biogenesis factor 7
Synonyms: peroxisome biogenesis factor 7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18634
HGNC: HGNC:8860
Homologene: 242
Esco2
Name: establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms: D030072L07Rik, 2410004I17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71988
Homologene: 12432
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60611
Homologene: 10187
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, C2pa, PDZ-RGS3, RGS3S, C2PA-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 10,409,321 bp (GRCm38)
  • T to C, chromosome 1 at 39,685,514 bp (GRCm38)
  • A to G, chromosome 1 at 46,214,404 bp (GRCm38)
  • C to T, chromosome 1 at 75,490,840 bp (GRCm38)
  • T to A, chromosome 1 at 90,785,928 bp (GRCm38)
  • A to G, chromosome 1 at 110,048,905 bp (GRCm38)
  • T to A, chromosome 1 at 135,890,082 bp (GRCm38)
  • T to C, chromosome 1 at 173,755,971 bp (GRCm38)
  • A to G, chromosome 2 at 86,236,494 bp (GRCm38)
  • A to T, chromosome 2 at 92,951,404 bp (GRCm38)
  • A to G, chromosome 2 at 162,932,089 bp (GRCm38)
  • G to A, chromosome 2 at 164,743,077 bp (GRCm38)
  • G to T, chromosome 2 at 165,112,570 bp (GRCm38)
  • A to G, chromosome 2 at 174,457,610 bp (GRCm38)
  • A to G, chromosome 3 at 87,733,177 bp (GRCm38)
  • A to T, chromosome 3 at 95,740,241 bp (GRCm38)
  • A to T, chromosome 4 at 62,657,175 bp (GRCm38)
  • G to A, chromosome 4 at 74,119,818 bp (GRCm38)
  • A to G, chromosome 4 at 144,456,419 bp (GRCm38)
  • AACT to A, chromosome 5 at 25,950,851 bp (GRCm38)
  • T to C, chromosome 5 at 87,254,385 bp (GRCm38)
  • T to C, chromosome 5 at 90,469,503 bp (GRCm38)
  • T to G, chromosome 5 at 91,146,694 bp (GRCm38)
  • T to A, chromosome 5 at 142,718,478 bp (GRCm38)
  • A to G, chromosome 5 at 149,750,429 bp (GRCm38)
  • AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC to AGGCCCAGCC, chromosome 6 at 48,988,018 bp (GRCm38)
  • A to G, chromosome 6 at 122,842,833 bp (GRCm38)
  • T to C, chromosome 6 at 136,612,246 bp (GRCm38)
  • A to G, chromosome 7 at 12,670,885 bp (GRCm38)
  • T to C, chromosome 7 at 27,989,850 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • T to A, chromosome 7 at 42,476,346 bp (GRCm38)
  • C to T, chromosome 7 at 55,813,485 bp (GRCm38)
  • T to A, chromosome 7 at 110,809,846 bp (GRCm38)
  • T to A, chromosome 8 at 4,213,291 bp (GRCm38)
  • A to T, chromosome 8 at 77,720,305 bp (GRCm38)
  • A to T, chromosome 9 at 4,503,560 bp (GRCm38)
  • A to G, chromosome 9 at 58,366,641 bp (GRCm38)
  • A to G, chromosome 9 at 59,827,183 bp (GRCm38)
  • A to T, chromosome 9 at 89,944,868 bp (GRCm38)
  • G to A, chromosome 10 at 19,887,113 bp (GRCm38)
  • T to C, chromosome 10 at 81,420,668 bp (GRCm38)
  • C to G, chromosome 10 at 94,813,142 bp (GRCm38)
  • T to A, chromosome 11 at 20,829,439 bp (GRCm38)
  • T to C, chromosome 11 at 65,848,373 bp (GRCm38)
  • T to C, chromosome 11 at 102,259,341 bp (GRCm38)
  • T to C, chromosome 11 at 110,086,548 bp (GRCm38)
  • A to G, chromosome 11 at 115,879,958 bp (GRCm38)
  • A to T, chromosome 11 at 119,157,855 bp (GRCm38)
  • A to G, chromosome 12 at 59,050,341 bp (GRCm38)
  • A to G, chromosome 12 at 70,163,463 bp (GRCm38)
  • T to A, chromosome 14 at 54,936,748 bp (GRCm38)
  • T to C, chromosome 14 at 65,831,303 bp (GRCm38)
  • G to A, chromosome 15 at 64,920,196 bp (GRCm38)
  • G to A, chromosome 15 at 102,498,506 bp (GRCm38)
  • A to T, chromosome 15 at 103,527,062 bp (GRCm38)
  • T to C, chromosome 16 at 81,512,999 bp (GRCm38)
  • T to C, chromosome 17 at 24,265,506 bp (GRCm38)
  • T to C, chromosome 17 at 90,589,969 bp (GRCm38)
  • A to C, chromosome 18 at 20,525,221 bp (GRCm38)
  • A to G, chromosome 18 at 37,265,463 bp (GRCm38)
  • A to T, chromosome 18 at 37,473,837 bp (GRCm38)
  • T to C, chromosome 18 at 65,161,652 bp (GRCm38)
  • A to G, chromosome 19 at 4,803,467 bp (GRCm38)
  • G to T, chromosome 19 at 10,254,854 bp (GRCm38)
  • T to A, chromosome 19 at 56,436,335 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9498 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069301-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.