Strain Name:
C57BL/6J-MtgxR9499Btlr/Mmmh
Stock Number:
069302-MU
Citation ID:
RRID:MMRRC_069302-MU
Other Names:
R9499 (G1)
Major Collection:

Strain Information

Phb1
Name: prohibitin 1
Synonyms: Phb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18673
HGNC: HGNC:8912
Homologene: 1980
Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, 1300007O05Rik, Apoav
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66113
Homologene: 14197
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: Her4, ErbB4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Zfp710
Name: zinc finger protein 710
Synonyms: 5430400N05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209225
Homologene: 19625
Depdc7
Name: DEP domain containing 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211896
Homologene: 16386
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: flat, RAPT1, 2610315D21Rik, RAFT1, Frap1, mechanistic target of rapamycin (serine/threonine kinase), FKBP-rapamycin-associated protein FRAP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Cep290
Name: centrosomal protein 290
Synonyms: Kiaa, b2b1454Clo, b2b1752Clo, Nphp6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: C130058G22Rik, CSB, CS group B correcting gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Ssb
Name: small RNA binding exonuclease protection factor La
Synonyms: Sjogren syndrome antigen B, La protein, SS-B, autoantigen La
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20823
Homologene: 2366
Slu7
Name: SLU7 splicing factor homolog (S. cerevisiae)
Synonyms: D3Bwg0878e, D11Ertd730e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193116
Homologene: 4690
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA116, D630020H17Rik, RPA2, Rpo1-2, 128kDa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Slitrk5
Name: SLIT and NTRK-like family, member 5
Synonyms: 2610019D03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75409
VEGA: 14
Homologene: 9193
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22041
Homologene: 68153
Hnrnpk
Name: heterogeneous nuclear ribonucleoprotein K
Synonyms: hnRNPK, Hnrpk, KBBP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15387
HGNC: HGNC:5044
Homologene: 81909
Arhgef17
Name: Rho guanine nucleotide exchange factor 17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207212
Homologene: 129601
Cep120
Name: centrosomal protein 120
Synonyms: Ccdc100
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225523
VEGA: 18
Homologene: 27415
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 672125
Homologene: 129606
Nmd3
Name: NMD3 ribosome export adaptor
Synonyms: C87860
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 97112
Homologene: 6127
Inpp5f
Name: inositol polyphosphate-5-phosphatase F
Synonyms: SAC2, 5830435P03Rik, cI-27
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101490
Homologene: 8962
Patl1
Name: protein associated with topoisomerase II homolog 1 (yeast)
Synonyms: Pat1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225929
VEGA: 19
Homologene: 82269
Nr2e1
Name: nuclear receptor subfamily 2, group E, member 1
Synonyms: Nr2e1, tailless, Mtll, Tlx
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21907
HGNC: HGNC:7973
Homologene: 37750
Il15
Name: interleukin 15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16168
HGNC: HGNC:5977
Homologene: 487
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: Piezo2, Fam38b, 9030411M15Rik, Fam38b2, 9430028L06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: crash, Adgrc1, Crsh, Scy
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: SM2, SM1, smMHC
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Cyp2j7
Name: cytochrome P450, family 2, subfamily j, polypeptide 7
Synonyms: OTTMUSG00000007941, Cyp2j7-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 546837
HGNC: HGNC:2634
Stc2
Name: stanniocalcin 2
Synonyms: mustc2, Stc2l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20856
Homologene: 2753
Madd
Name: MAP-kinase activating death domain
Synonyms: Rab3 GEP, 9630059K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228355
HGNC: HGNC:6766
Homologene: 14249
Arhgef5
Name: Rho guanine nucleotide exchange factor 5
Synonyms: 2210412D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54324
Homologene: 66300
Ucp1
Name: uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms: Slc25a7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22227
Homologene: 22524
Vmn1r24
Name: vomeronasal 1 receptor 24
Synonyms: V1rc18
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171191
Homologene: 134024
Zfp595
Name: zinc finger protein 595
Synonyms: A230042K10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218314
Homologene: 120258
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74441
Homologene: 65259
Dnaaf11
Name: dynein axonemal assembly factor 11
Synonyms: LRTP, Lrrc6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54562
Homologene: 34534
Tle5
Name: TLE family member 5, transcriptional modulator
Synonyms: Aes, Grg5, AES, Grg
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14797
VEGA: 10
HGNC: HGNC:307
Homologene: 879
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: Semcap3, LNX3, 1110020C07Rik, semaphorin cytoplasmic domain-associated protein 3A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435864
Homologene: 129606
Nrxn1
Name: neurexin I
Synonyms: alpha-latrotoxin receptor (calcium-dependent), 1700062G21Rik, neurexin I alpha, 9330127H16Rik, neurexin I alpha, neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I beta, A230068P09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Rpain
Name: RPA interacting protein
Synonyms: 2400006N03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69723
Homologene: 13006
Pck2
Name: phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms: 9130022B02Rik, 1810010O14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74551
VEGA: 14
HGNC: HGNC:8725
Homologene: 3356
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: TG K, TGase 1, K polypeptide, 2310004J08Rik, protein-glutamine-gamma-glutamyltransferase, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Rexo5
Name: RNA exonuclease 5
Synonyms: 2610020H08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434234
Homologene: 12803
Hs3st6
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328779
VEGA: 17
Homologene: 84633
Plin1
Name: perilipin 1
Synonyms: Plin, 6030432J05Rik, Peri, perilipin A, perilipin B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 103968
HGNC: HGNC:9076
Homologene: 2001
Zfp827
Name: zinc finger protein 827
Synonyms: D630040G17Rik, 2810449M09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622675
Homologene: 45622
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Mfsd9
Name: major facilitator superfamily domain containing 9
Synonyms: 4931419K03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211798
Homologene: 13100
Gm8159
Name: predicted gene 8159
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666549
Homologene: 115686
Sult2a8
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 8
Synonyms: mL-STL, 2810007J24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76971
Gm14401
Name: predicted gene 14401
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100534275
Yipf4
Name: Yip1 domain family, member 4
Synonyms: 2310034L04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67864
VEGA: 17
Homologene: 32658
Abhd6
Name: abhydrolase domain containing 6
Synonyms: 0610041D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66082
VEGA: 14
Homologene: 23246
Mbl2
Name: mannose-binding lectin (protein C) 2
Synonyms: MBL-C, MBL, MBP-C
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17195
VEGA: 19
HGNC: HGNC:6922
Homologene: 110436
Zscan4c
Name: zinc finger and SCAN domain containing 4C
Synonyms: LOC245109
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245109
Homologene: 85986
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 40,773,992 bp (GRCm38)
  • G to A, chromosome 1 at 68,740,483 bp (GRCm38)
  • T to C, chromosome 1 at 97,128,102 bp (GRCm38)
  • C to A, chromosome 1 at 136,527,481 bp (GRCm38)
  • A to T, chromosome 2 at 20,881,586 bp (GRCm38)
  • T to A, chromosome 2 at 69,866,638 bp (GRCm38)
  • T to C, chromosome 2 at 91,170,089 bp (GRCm38)
  • C to T, chromosome 2 at 104,722,875 bp (GRCm38)
  • C to T, chromosome 2 at 129,115,764 bp (GRCm38)
  • C to A, chromosome 2 at 150,267,936 bp (GRCm38)
  • C to T, chromosome 2 at 177,086,544 bp (GRCm38)
  • A to G, chromosome 2 at 181,996,386 bp (GRCm38)
  • T to C, chromosome 3 at 69,739,996 bp (GRCm38)
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp (GRCm38)
  • C to T, chromosome 4 at 96,227,603 bp (GRCm38)
  • C to T, chromosome 4 at 148,514,940 bp (GRCm38)
  • T to A, chromosome 5 at 108,847,718 bp (GRCm38)
  • A to T, chromosome 6 at 43,284,006 bp (GRCm38)
  • T to A, chromosome 6 at 57,956,165 bp (GRCm38)
  • T to C, chromosome 6 at 101,150,894 bp (GRCm38)
  • T to C, chromosome 7 at 11,006,926 bp (GRCm38)
  • A to C, chromosome 7 at 14,423,562 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • T to C, chromosome 7 at 79,722,796 bp (GRCm38)
  • A to G, chromosome 7 at 80,081,873 bp (GRCm38)
  • T to C, chromosome 7 at 100,876,895 bp (GRCm38)
  • A to G, chromosome 7 at 119,805,257 bp (GRCm38)
  • A to T, chromosome 7 at 128,693,713 bp (GRCm38)
  • T to G, chromosome 8 at 79,060,774 bp (GRCm38)
  • T to A, chromosome 8 at 82,334,548 bp (GRCm38)
  • T to C, chromosome 8 at 83,297,880 bp (GRCm38)
  • G to C, chromosome 9 at 46,270,646 bp (GRCm38)
  • C to T, chromosome 9 at 103,222,084 bp (GRCm38)
  • A to T, chromosome 10 at 42,571,491 bp (GRCm38)
  • T to C, chromosome 10 at 81,564,154 bp (GRCm38)
  • T to C, chromosome 10 at 100,536,867 bp (GRCm38)
  • A to G, chromosome 11 at 31,360,332 bp (GRCm38)
  • G to A, chromosome 11 at 43,438,268 bp (GRCm38)
  • T to C, chromosome 11 at 70,974,990 bp (GRCm38)
  • G to A, chromosome 11 at 95,671,431 bp (GRCm38)
  • A to G, chromosome 13 at 58,396,244 bp (GRCm38)
  • A to T, chromosome 13 at 67,317,003 bp (GRCm38)
  • T to A, chromosome 14 at 4,635,265 bp (GRCm38)
  • T to C, chromosome 14 at 8,028,329 bp (GRCm38)
  • C to T, chromosome 14 at 32,562,568 bp (GRCm38)
  • T to A, chromosome 14 at 55,542,624 bp (GRCm38)
  • T to C, chromosome 14 at 55,713,476 bp (GRCm38)
  • C to T, chromosome 14 at 111,679,064 bp (GRCm38)
  • T to C, chromosome 15 at 66,489,634 bp (GRCm38)
  • G to T, chromosome 15 at 86,033,085 bp (GRCm38)
  • T to A, chromosome 16 at 14,246,809 bp (GRCm38)
  • T to C, chromosome 16 at 17,307,710 bp (GRCm38)
  • T to C, chromosome 17 at 24,758,254 bp (GRCm38)
  • T to C, chromosome 17 at 74,499,029 bp (GRCm38)
  • T to A, chromosome 17 at 74,609,069 bp (GRCm38)
  • T to C, chromosome 17 at 90,630,022 bp (GRCm38)
  • C to A, chromosome 18 at 53,685,961 bp (GRCm38)
  • T to C, chromosome 18 at 63,032,962 bp (GRCm38)
  • T to A, chromosome 19 at 11,920,364 bp (GRCm38)
  • G to A, chromosome 19 at 30,239,264 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9499 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069302-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.