Strain Name:
C57BL/6J-MtgxR9500Btlr/Mmmh
Stock Number:
069303-MU
Citation ID:
RRID:MMRRC_069303-MU
Other Names:
R9500 (G1)
Major Collection:

Strain Information

Lars1
Name: leucyl-tRNA synthetase 1
Synonyms: 3110009L02Rik, 2310045K21Rik, Lars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107045
VEGA: 18
HGNC: HGNC:6512
Homologene: 7083
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, 9530011I20Rik, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Suclg2
Name: succinate-Coenzyme A ligase, GDP-forming, beta subunit
Synonyms: D6Wsu120e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20917
Homologene: 2854
Atf6
Name: activating transcription factor 6
Synonyms: ESTM49, 9130025P16Rik, Atf6alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226641
HGNC: HGNC:791
Homologene: 32015
Polk
Name: polymerase (DNA directed), kappa
Synonyms: Dinb1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27015
VEGA: 13
HGNC: HGNC:9183
Homologene: 32140
Auts2
Name: autism susceptibility candidate 2
Synonyms: D830032G16Rik, A730011F23Rik, 2700063G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319974
Homologene: 22907
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Dcaf8
Name: DDB1 and CUL4 associated factor 8
Synonyms: H326, D1Ucla4, D1Dau35e, Wdr42a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98193
Homologene: 56725
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Gbf1
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107338
HGNC: HGNC:4181
Homologene: 37897
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Slitrk5
Name: SLIT and NTRK-like family, member 5
Synonyms: 2610019D03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75409
VEGA: 14
Homologene: 9193
Clint1
Name: clathrin interactor 1
Synonyms: Epn4, C530049I24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216705
Homologene: 133740
Crebbp
Name: CREB binding protein
Synonyms: CBP, KAT3A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12914
HGNC: HGNC:2348
Homologene: 68393
Colec11
Name: collectin sub-family member 11
Synonyms: 1010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71693
VEGA: 12
Homologene: 11423
2310022A10Rik
Name: RIKEN cDNA 2310022A10 gene
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66367
Homologene: 35272
Cblb
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
HGNC: HGNC:1542
Homologene: 15856
Akap11
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Rag2
Name: recombination activating gene 2
Synonyms: Rag-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19374
HGNC: HGNC:9832
Homologene: 7507
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Taf5
Name: TATA-box binding protein associated factor 5
Synonyms: 6330528C20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226182
VEGA: 19
Homologene: 5064
Eogt
Name: EGF domain specific O-linked N-acetylglucosamine transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101351
Homologene: 65276
Drc3
Name: dynein regulatory complex subunit 3
Synonyms: 4930449E07Rik, Lrrc48, m6Bei
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74665
Homologene: 12581
Eml1
Name: echinoderm microtubule associated protein like 1
Synonyms: ELP79, 1110008N23Rik, A930030P13Rik, heco
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68519
HGNC: HGNC:3330
Homologene: 20931
Mmp23
Name: matrix metallopeptidase 23
Synonyms: cysteine array matrix metalloproteinase, CA-MMP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26561
HGNC: HGNC:7171
Homologene: 3424
Ifit1bl2
Name: interferon induced protein with tetratricopeptide repeats 1B like 2
Synonyms: 2010002M12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 112419
Homologene: 78213
Pla2g2c
Name: phospholipase A2, group IIC
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18781
HGNC: HGNC:9032
Homologene: 7477
Sema3a
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: SemD, semaphorin III, sema III, collapsin-1, Semad
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20346
Homologene: 31358
Stil
Name: Scl/Tal1 interrupting locus
Synonyms: Sil
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20460
Homologene: 2283
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Phf19
Name: PHD finger protein 19
Synonyms: 3110009G19Rik, 3321402G02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74016
Homologene: 12524
Pam
Name: peptidylglycine alpha-amidating monooxygenase
Synonyms: PHM
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18484
HGNC: HGNC:8596
Homologene: 37369
Myo15b
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Mical2
Name: microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms: 5330438E18Rik, Ebitein1, 4921517J23Rik, Micalcl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320878
Homologene: 8760
Igsf6
Name: immunoglobulin superfamily, member 6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80719
HGNC: HGNC:5953
Homologene: 36189
Ptk6
Name: PTK6 protein tyrosine kinase 6
Synonyms: Sik, Tksk
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20459
HGNC: HGNC:9617
Homologene: 68494
Bcl3
Name: B cell leukemia/lymphoma 3
Synonyms: Bcl-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12051
HGNC: HGNC:998
Homologene: 81738
Mrpl23
Name: mitochondrial ribosomal protein L23
Synonyms: L23mrp, Rpl23l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19935
Homologene: 7922
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Arhgap31
Name: Rho GTPase activating protein 31
Synonyms: CdGAP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12549
Homologene: 10644
Palm3
Name: paralemmin 3
Synonyms: 4432412L15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74337
Homologene: 53493
Nanog
Name: Nanog homeobox
Synonyms: 2410002E02Rik, ENK, ecat4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71950
Homologene: 78027
Lmo3
Name: LIM domain only 3
Synonyms: Rbtn-3, Rbtn3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109593
HGNC: HGNC:6643
Homologene: 38552
Gtpbp10
Name: GTP-binding protein 10 (putative)
Synonyms: 4930545J22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207704
Homologene: 8114
Arhgap25
Name: Rho GTPase activating protein 25
Synonyms: A130039I20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232201
Homologene: 45507
Slc7a11
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms: System xc, xc, xCT, sut, 9930009M05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26570
Homologene: 22684
Clvs1
Name: clavesin 1
Synonyms: 4933402J24Rik, Rlbp1l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74438
Homologene: 65267
Krtap9-21
Name: keratin associated protein 9-21
Synonyms: Gm11568
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432600
Ehd2
Name: EH-domain containing 2
Synonyms: C130052H20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259300
HGNC: HGNC:3243
Homologene: 22825
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Mmp24
Name: matrix metallopeptidase 24
Synonyms: MT5-MMP, Membrane type 5-MMP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17391
HGNC: HGNC:7172
Homologene: 21331
Pla2g4f
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271844
Homologene: 77933
Txndc16
Name: thioredoxin domain containing 16
Synonyms: 5730420B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70561
Homologene: 18197
Or13p4
Name: olfactory receptor family 13 subfamily P member 4
Synonyms: GA_x6K02T2QD9B-18856980-18857927, MOR258-3, Olfr1342
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258708
Homologene: 17357
Anxa10
Name: annexin A10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26359
HGNC: HGNC:534
Homologene: 21409
Mrgpra3
Name: MAS-related GPR, member A3
Synonyms: G protein-coupled receptor, MrgA3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233222
Homologene: 131159
Rsl1d1
Name: ribosomal L1 domain containing 1
Synonyms: 2410005K20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66409
Homologene: 41052
Nkg7
Name: natural killer cell group 7 sequence
Synonyms: 2500004F03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72310
HGNC: HGNC:7830
Homologene: 4092
Amz1
Name: archaelysin family metallopeptidase 1
Synonyms: 6530401C20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231842
Homologene: 18290
Acyp1
Name: acylphosphatase 1
Synonyms: 1110039O14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66204
HGNC: HGNC:179
Homologene: 11932
Samd14
Name: sterile alpha motif domain containing 14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217125
Homologene: 17130
Prox2
Name: prospero homeobox 2
Synonyms: 1700058C01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73422
Homologene: 18421
Tes3-ps
Name: testis derived transcript 3, pseudogene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54339
VEGA: 13
Mup1
Name: major urinary protein 1
Synonyms: Mup-a, Up-1, Mup-1, Lvtn-1, Ltn-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17840
Homologene: 74304
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 38,063,133 bp (GRCm38)
  • T to C, chromosome 1 at 97,844,600 bp (GRCm38)
  • T to C, chromosome 1 at 139,432,068 bp (GRCm38)
  • T to C, chromosome 1 at 170,747,139 bp (GRCm38)
  • C to G, chromosome 1 at 172,172,342 bp (GRCm38)
  • A to T, chromosome 2 at 34,911,696 bp (GRCm38)
  • T to C, chromosome 2 at 76,723,650 bp (GRCm38)
  • G to A, chromosome 2 at 101,630,872 bp (GRCm38)
  • T to A, chromosome 2 at 120,312,232 bp (GRCm38)
  • T to C, chromosome 2 at 155,812,275 bp (GRCm38)
  • A to G, chromosome 2 at 181,195,773 bp (GRCm38)
  • G to A, chromosome 3 at 50,427,752 bp (GRCm38)
  • A to G, chromosome 3 at 79,066,786 bp (GRCm38)
  • A to G, chromosome 3 at 97,888,580 bp (GRCm38)
  • A to G, chromosome 4 at 9,429,834 bp (GRCm38)
  • C to T, chromosome 4 at 57,205,914 bp (GRCm38)
  • A to G, chromosome 4 at 60,500,489 bp (GRCm38)
  • A to T, chromosome 4 at 115,021,519 bp (GRCm38)
  • A to G, chromosome 4 at 118,689,733 bp (GRCm38)
  • A to T, chromosome 4 at 138,734,378 bp (GRCm38)
  • A to G, chromosome 4 at 155,652,110 bp (GRCm38)
  • A to T, chromosome 5 at 5,556,120 bp (GRCm38)
  • A to T, chromosome 5 at 13,565,887 bp (GRCm38)
  • A to G, chromosome 5 at 14,675,634 bp (GRCm38)
  • C to A, chromosome 5 at 131,476,781 bp (GRCm38)
  • T to C, chromosome 5 at 140,752,220 bp (GRCm38)
  • A to T, chromosome 6 at 4,756,871 bp (GRCm38)
  • T to C, chromosome 6 at 87,492,202 bp (GRCm38)
  • C to A, chromosome 6 at 95,569,685 bp (GRCm38)
  • T to C, chromosome 6 at 97,120,031 bp (GRCm38)
  • G to T, chromosome 6 at 122,713,260 bp (GRCm38)
  • G to T, chromosome 6 at 138,416,623 bp (GRCm38)
  • T to A, chromosome 7 at 10,171,354 bp (GRCm38)
  • T to C, chromosome 7 at 15,952,152 bp (GRCm38)
  • T to C, chromosome 7 at 19,822,677 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • C to T, chromosome 7 at 27,565,666 bp (GRCm38)
  • A to G, chromosome 7 at 43,437,805 bp (GRCm38)
  • A to T, chromosome 7 at 47,589,652 bp (GRCm38)
  • T to C, chromosome 7 at 105,704,502 bp (GRCm38)
  • A to T, chromosome 7 at 112,336,847 bp (GRCm38)
  • A to G, chromosome 7 at 121,074,474 bp (GRCm38)
  • G to A, chromosome 7 at 142,536,122 bp (GRCm38)
  • C to T, chromosome 8 at 62,092,511 bp (GRCm38)
  • T to C, chromosome 8 at 84,027,007 bp (GRCm38)
  • G to T, chromosome 10 at 86,729,862 bp (GRCm38)
  • T to A, chromosome 11 at 23,381,337 bp (GRCm38)
  • T to G, chromosome 11 at 45,906,367 bp (GRCm38)
  • A to G, chromosome 11 at 60,370,508 bp (GRCm38)
  • T to A, chromosome 11 at 95,023,546 bp (GRCm38)
  • GCTGCTGCCAGCCCTGCTGCCAGCCC to GCTGCTGCCAGCCCTGCTGCCAGCCCTGCTGCCAGCCC, chromosome 11 at 99,858,218 bp (GRCm38)
  • AGCCC to AGCCCTGCTGCCTGCCC, chromosome 11 at 99,858,239 bp (GRCm38)
  • T to C, chromosome 11 at 115,886,640 bp (GRCm38)
  • A to C, chromosome 12 at 28,595,303 bp (GRCm38)
  • T to A, chromosome 12 at 85,088,077 bp (GRCm38)
  • T to A, chromosome 12 at 85,279,012 bp (GRCm38)
  • T to A, chromosome 12 at 108,527,699 bp (GRCm38)
  • T to A, chromosome 13 at 49,494,339 bp (GRCm38)
  • G to T, chromosome 13 at 96,493,841 bp (GRCm38)
  • A to T, chromosome 14 at 45,169,341 bp (GRCm38)
  • A to T, chromosome 14 at 78,511,103 bp (GRCm38)
  • A to G, chromosome 14 at 111,679,294 bp (GRCm38)
  • A to G, chromosome 15 at 8,112,316 bp (GRCm38)
  • C to T, chromosome 16 at 4,093,491 bp (GRCm38)
  • T to A, chromosome 16 at 11,193,521 bp (GRCm38)
  • T to A, chromosome 16 at 15,839,215 bp (GRCm38)
  • T to A, chromosome 16 at 38,640,321 bp (GRCm38)
  • T to C, chromosome 16 at 52,139,630 bp (GRCm38)
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp (GRCm38)
  • C to T, chromosome 16 at 93,810,283 bp (GRCm38)
  • A to T, chromosome 18 at 42,228,661 bp (GRCm38)
  • T to C, chromosome 18 at 49,878,204 bp (GRCm38)
  • A to T, chromosome 19 at 34,619,108 bp (GRCm38)
  • T to C, chromosome 19 at 40,809,396 bp (GRCm38)
  • A to G, chromosome 19 at 46,269,950 bp (GRCm38)
  • A to G, chromosome 19 at 47,077,332 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9500 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069303-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.