Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9500Btlr/Mmmh
Stock Number:
069303-MU
Citation ID:
RRID:MMRRC_069303-MU
Other Names:
R9500 (G1)
Major Collection:

Strain Information

Lars1
Name: leucyl-tRNA synthetase 1
Synonyms: 3110009L02Rik, 2310045K21Rik, Lars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107045
VEGA: 18
HGNC: HGNC:6512
Homologene: 7083
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, 9530011I20Rik, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Suclg2
Name: succinate-Coenzyme A ligase, GDP-forming, beta subunit
Synonyms: D6Wsu120e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20917
Homologene: 2854
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 38,063,133 bp (GRCm38)
  • T to C, chromosome 1 at 97,844,600 bp (GRCm38)
  • T to C, chromosome 1 at 139,432,068 bp (GRCm38)
  • T to C, chromosome 1 at 170,747,139 bp (GRCm38)
  • C to G, chromosome 1 at 172,172,342 bp (GRCm38)
  • A to T, chromosome 2 at 34,911,696 bp (GRCm38)
  • T to C, chromosome 2 at 76,723,650 bp (GRCm38)
  • G to A, chromosome 2 at 101,630,872 bp (GRCm38)
  • T to A, chromosome 2 at 120,312,232 bp (GRCm38)
  • T to C, chromosome 2 at 155,812,275 bp (GRCm38)
  • A to G, chromosome 2 at 181,195,773 bp (GRCm38)
  • G to A, chromosome 3 at 50,427,752 bp (GRCm38)
  • A to G, chromosome 3 at 79,066,786 bp (GRCm38)
  • A to G, chromosome 3 at 97,888,580 bp (GRCm38)
  • A to G, chromosome 4 at 9,429,834 bp (GRCm38)
  • C to T, chromosome 4 at 57,205,914 bp (GRCm38)
  • A to G, chromosome 4 at 60,500,489 bp (GRCm38)
  • A to T, chromosome 4 at 115,021,519 bp (GRCm38)
  • A to G, chromosome 4 at 118,689,733 bp (GRCm38)
  • A to T, chromosome 4 at 138,734,378 bp (GRCm38)
  • A to G, chromosome 4 at 155,652,110 bp (GRCm38)
  • A to T, chromosome 5 at 5,556,120 bp (GRCm38)
  • A to T, chromosome 5 at 13,565,887 bp (GRCm38)
  • A to G, chromosome 5 at 14,675,634 bp (GRCm38)
  • C to A, chromosome 5 at 131,476,781 bp (GRCm38)
  • T to C, chromosome 5 at 140,752,220 bp (GRCm38)
  • A to T, chromosome 6 at 4,756,871 bp (GRCm38)
  • T to C, chromosome 6 at 87,492,202 bp (GRCm38)
  • C to A, chromosome 6 at 95,569,685 bp (GRCm38)
  • T to C, chromosome 6 at 97,120,031 bp (GRCm38)
  • G to T, chromosome 6 at 122,713,260 bp (GRCm38)
  • G to T, chromosome 6 at 138,416,623 bp (GRCm38)
  • T to A, chromosome 7 at 10,171,354 bp (GRCm38)
  • T to C, chromosome 7 at 15,952,152 bp (GRCm38)
  • T to C, chromosome 7 at 19,822,677 bp (GRCm38)
  • G to A, chromosome 7 at 27,155,292 bp (GRCm38)
  • C to T, chromosome 7 at 27,565,666 bp (GRCm38)
  • A to G, chromosome 7 at 43,437,805 bp (GRCm38)
  • A to T, chromosome 7 at 47,589,652 bp (GRCm38)
  • T to C, chromosome 7 at 105,704,502 bp (GRCm38)
  • A to T, chromosome 7 at 112,336,847 bp (GRCm38)
  • A to G, chromosome 7 at 121,074,474 bp (GRCm38)
  • G to A, chromosome 7 at 142,536,122 bp (GRCm38)
  • C to T, chromosome 8 at 62,092,511 bp (GRCm38)
  • T to C, chromosome 8 at 84,027,007 bp (GRCm38)
  • G to T, chromosome 10 at 86,729,862 bp (GRCm38)
  • T to A, chromosome 11 at 23,381,337 bp (GRCm38)
  • T to G, chromosome 11 at 45,906,367 bp (GRCm38)
  • A to G, chromosome 11 at 60,370,508 bp (GRCm38)
  • T to A, chromosome 11 at 95,023,546 bp (GRCm38)
  • GCTGCTGCCAGCCCTGCTGCCAGCCC to GCTGCTGCCAGCCCTGCTGCCAGCCCTGCTGCCAGCCC, chromosome 11 at 99,858,218 bp (GRCm38)
  • AGCCC to AGCCCTGCTGCCTGCCC, chromosome 11 at 99,858,239 bp (GRCm38)
  • T to C, chromosome 11 at 115,886,640 bp (GRCm38)
  • A to C, chromosome 12 at 28,595,303 bp (GRCm38)
  • T to A, chromosome 12 at 85,088,077 bp (GRCm38)
  • T to A, chromosome 12 at 85,279,012 bp (GRCm38)
  • T to A, chromosome 12 at 108,527,699 bp (GRCm38)
  • T to A, chromosome 13 at 49,494,339 bp (GRCm38)
  • G to T, chromosome 13 at 96,493,841 bp (GRCm38)
  • A to T, chromosome 14 at 45,169,341 bp (GRCm38)
  • A to T, chromosome 14 at 78,511,103 bp (GRCm38)
  • A to G, chromosome 14 at 111,679,294 bp (GRCm38)
  • A to G, chromosome 15 at 8,112,316 bp (GRCm38)
  • C to T, chromosome 16 at 4,093,491 bp (GRCm38)
  • T to A, chromosome 16 at 11,193,521 bp (GRCm38)
  • T to A, chromosome 16 at 15,839,215 bp (GRCm38)
  • T to A, chromosome 16 at 38,640,321 bp (GRCm38)
  • T to C, chromosome 16 at 52,139,630 bp (GRCm38)
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp (GRCm38)
  • C to T, chromosome 16 at 93,810,283 bp (GRCm38)
  • A to T, chromosome 18 at 42,228,661 bp (GRCm38)
  • T to C, chromosome 18 at 49,878,204 bp (GRCm38)
  • A to T, chromosome 19 at 34,619,108 bp (GRCm38)
  • T to C, chromosome 19 at 40,809,396 bp (GRCm38)
  • A to G, chromosome 19 at 46,269,950 bp (GRCm38)
  • A to G, chromosome 19 at 47,077,332 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9500 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069303-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.