Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9513Btlr/Mmmh
Stock Number:
069315-MU
Citation ID:
RRID:MMRRC_069315-MU
Other Names:
R9513 (G1)
Major Collection:

Strain Information

Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Nr2f2
Name: nuclear receptor subfamily 2, group F, member 2
Synonyms: COUP-TFII, ARP-1, Tcfcoup2, Aporp1, COUP-TF2, 9430015G03Rik, EAR3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11819
HGNC: HGNC:7976
Homologene: 7628
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Tfr2
Name: transferrin receptor 2
Synonyms: Tfr2, Trfr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50765
Homologene: 2428
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 43,978,488 bp (GRCm38)
  • A to T, chromosome 1 at 96,871,918 bp (GRCm38)
  • T to A, chromosome 1 at 154,442,287 bp (GRCm38)
  • G to A, chromosome 1 at 158,246,703 bp (GRCm38)
  • A to T, chromosome 1 at 166,634,972 bp (GRCm38)
  • T to C, chromosome 2 at 4,603,900 bp (GRCm38)
  • C to T, chromosome 2 at 26,670,601 bp (GRCm38)
  • A to T, chromosome 2 at 86,423,363 bp (GRCm38)
  • T to A, chromosome 2 at 87,809,843 bp (GRCm38)
  • A to T, chromosome 2 at 89,817,209 bp (GRCm38)
  • T to C, chromosome 2 at 90,801,114 bp (GRCm38)
  • T to C, chromosome 2 at 93,869,153 bp (GRCm38)
  • T to C, chromosome 2 at 121,499,603 bp (GRCm38)
  • T to C, chromosome 2 at 174,343,296 bp (GRCm38)
  • T to C, chromosome 3 at 104,785,818 bp (GRCm38)
  • G to A, chromosome 3 at 105,665,547 bp (GRCm38)
  • T to A, chromosome 3 at 138,282,810 bp (GRCm38)
  • T to A, chromosome 4 at 99,984,045 bp (GRCm38)
  • G to A, chromosome 4 at 124,659,042 bp (GRCm38)
  • T to A, chromosome 4 at 144,333,108 bp (GRCm38)
  • C to T, chromosome 4 at 147,583,542 bp (GRCm38)
  • T to A, chromosome 5 at 21,375,792 bp (GRCm38)
  • T to C, chromosome 5 at 105,081,225 bp (GRCm38)
  • T to C, chromosome 5 at 121,378,774 bp (GRCm38)
  • T to A, chromosome 5 at 137,363,302 bp (GRCm38)
  • A to G, chromosome 5 at 137,577,507 bp (GRCm38)
  • G to C, chromosome 5 at 137,785,497 bp (GRCm38)
  • T to C, chromosome 6 at 42,305,528 bp (GRCm38)
  • T to C, chromosome 6 at 88,910,239 bp (GRCm38)
  • T to A, chromosome 6 at 107,568,544 bp (GRCm38)
  • T to A, chromosome 6 at 124,508,843 bp (GRCm38)
  • T to A, chromosome 6 at 131,689,783 bp (GRCm38)
  • T to A, chromosome 6 at 149,328,295 bp (GRCm38)
  • T to A, chromosome 6 at 149,512,893 bp (GRCm38)
  • T to A, chromosome 7 at 22,499,671 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to G, chromosome 7 at 35,776,148 bp (GRCm38)
  • G to T, chromosome 7 at 56,113,100 bp (GRCm38)
  • A to T, chromosome 7 at 70,360,308 bp (GRCm38)
  • T to C, chromosome 7 at 75,704,527 bp (GRCm38)
  • A to G, chromosome 7 at 98,097,611 bp (GRCm38)
  • T to A, chromosome 7 at 105,704,972 bp (GRCm38)
  • A to T, chromosome 7 at 114,232,197 bp (GRCm38)
  • T to A, chromosome 7 at 116,340,086 bp (GRCm38)
  • AGCAAC to A, chromosome 7 at 127,717,008 bp (GRCm38)
  • T to A, chromosome 7 at 140,162,909 bp (GRCm38)
  • A to T, chromosome 8 at 85,764,246 bp (GRCm38)
  • G to A, chromosome 8 at 110,595,482 bp (GRCm38)
  • G to T, chromosome 8 at 121,886,877 bp (GRCm38)
  • A to T, chromosome 9 at 14,614,767 bp (GRCm38)
  • A to G, chromosome 9 at 19,846,520 bp (GRCm38)
  • A to G, chromosome 9 at 26,883,787 bp (GRCm38)
  • T to C, chromosome 9 at 39,238,329 bp (GRCm38)
  • A to T, chromosome 9 at 100,497,316 bp (GRCm38)
  • T to A, chromosome 10 at 9,812,010 bp (GRCm38)
  • C to T, chromosome 10 at 60,331,216 bp (GRCm38)
  • T to A, chromosome 10 at 84,838,186 bp (GRCm38)
  • A to G, chromosome 10 at 116,302,237 bp (GRCm38)
  • T to A, chromosome 11 at 65,821,969 bp (GRCm38)
  • T to C, chromosome 11 at 73,047,901 bp (GRCm38)
  • T to A, chromosome 11 at 73,433,992 bp (GRCm38)
  • A to G, chromosome 11 at 77,974,583 bp (GRCm38)
  • T to G, chromosome 11 at 86,486,239 bp (GRCm38)
  • T to C, chromosome 12 at 51,769,296 bp (GRCm38)
  • A to G, chromosome 12 at 65,226,051 bp (GRCm38)
  • A to T, chromosome 13 at 67,669,516 bp (GRCm38)
  • T to A, chromosome 13 at 81,382,353 bp (GRCm38)
  • A to G, chromosome 13 at 100,690,367 bp (GRCm38)
  • T to A, chromosome 14 at 27,464,314 bp (GRCm38)
  • C to T, chromosome 14 at 60,692,400 bp (GRCm38)
  • G to A, chromosome 14 at 122,971,792 bp (GRCm38)
  • A to T, chromosome 15 at 9,007,302 bp (GRCm38)
  • T to C, chromosome 15 at 76,891,284 bp (GRCm38)
  • T to A, chromosome 15 at 89,590,428 bp (GRCm38)
  • A to T, chromosome 15 at 101,861,344 bp (GRCm38)
  • A to G, chromosome 16 at 17,530,288 bp (GRCm38)
  • G to T, chromosome 16 at 97,745,898 bp (GRCm38)
  • T to C, chromosome 16 at 97,806,504 bp (GRCm38)
  • A to G, chromosome 17 at 24,677,594 bp (GRCm38)
  • G to T, chromosome 17 at 46,258,807 bp (GRCm38)
  • A to G, chromosome 18 at 35,213,634 bp (GRCm38)
  • A to G, chromosome 18 at 36,932,233 bp (GRCm38)
  • A to G, chromosome 18 at 60,955,535 bp (GRCm38)
  • A to T, chromosome 18 at 78,856,566 bp (GRCm38)
  • T to C, chromosome 19 at 28,835,334 bp (GRCm38)
  • C to T, chromosome 19 at 46,068,061 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9513 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069315-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.