Strain Name:
C57BL/6J-MtgxR9513Btlr/Mmmh
Stock Number:
069315-MU
Citation ID:
RRID:MMRRC_069315-MU
Other Names:
R9513 (G1)
Major Collection:

Strain Information

Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Nr2f2
Name: nuclear receptor subfamily 2, group F, member 2
Synonyms: COUP-TFII, ARP-1, Tcfcoup2, Aporp1, COUP-TF2, 9430015G03Rik, EAR3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11819
HGNC: HGNC:7976
Homologene: 7628
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Tfr2
Name: transferrin receptor 2
Synonyms: Tfr2, Trfr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50765
Homologene: 2428
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Copb1
Name: coatomer protein complex, subunit beta 1
Synonyms: Copb1, 2610019B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70349
HGNC: HGNC:2231
Homologene: 5664
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Tjap1
Name: tight junction associated protein 1
Synonyms: 0610041D19Rik, Pilt, Tjp4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74094
VEGA: 17
Homologene: 12534
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Zfp985
Name: zinc finger protein 985
Synonyms: Gm13154
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433804
Homologene: 133076
Prdm15
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114604
Homologene: 56941
Mepce
Name: methylphosphate capping enzyme
Synonyms: D5Wsu46e, Bcdin3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231803
Homologene: 32447
Ncbp3
Name: nuclear cap binding subunit 3
Synonyms: 1200014J11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66874
Homologene: 10231
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Mfap1a
Name: microfibrillar-associated protein 1A
Synonyms: 4432409M24Rik, Mfap1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67532
HGNC: HGNC:7032
Homologene: 4332
Zfp738
Name: zinc finger protein 738
Synonyms: 6720487G11Rik, 3830402I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408068
Homologene: 133713
Itfg1
Name: integrin alpha FG-GAP repeat containing 1
Synonyms: 2310047C21Rik, D8Wsu49e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71927
Homologene: 12423
Nck1
Name: non-catalytic region of tyrosine kinase adaptor protein 1
Synonyms: Nck, D230010O13Rik, 6330586M15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17973
HGNC: HGNC:7664
Homologene: 38148
Zfp507
Name: zinc finger protein 507
Synonyms: A230056M16Rik, 1810022O10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668501
Homologene: 8942
Pprc1
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226169
Homologene: 9006
Slc7a5
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 5
Synonyms: TA1, D0H16S474E, LAT1, Gm42049
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20539
Homologene: 55759
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
C1rl
Name: complement component 1, r subcomponent-like
Synonyms: C1r-LP, C1rl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232371
Homologene: 9559
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: SMCC1, Clc-1, Clc1, NMF355, nmf355
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Ccdc125
Name: coiled-coil domain containing 125
Synonyms: 5830436D01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76041
VEGA: 13
Homologene: 27932
Slc1a1
Name: solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Synonyms: MEAAC1, EAAC1, EAAT3, D130048G10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20510
Homologene: 20881
Gm4847
Name: predicted gene 4847
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226604
Homologene: 101040
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Stxbp5
Name: syntaxin binding protein 5 (tomosyn)
Synonyms: 0710001E20Rik, LGL3, 4930565N16Rik, tomosyn 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78808
Homologene: 16402
Or7e169
Name: olfactory receptor family 7 subfamily E member 169
Synonyms: GA_x6K02T2PVTD-13586614-13585661, MOR146-2, Olfr860
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258521
Homologene: 134093
Fgl2
Name: fibrinogen-like protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14190
HGNC: HGNC:3696
Homologene: 4864
Ripk4
Name: receptor-interacting serine-threonine kinase 4
Synonyms: PKK, DIk, RIP4, ANKK2, Ankrd3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72388
HGNC: HGNC:496
Homologene: 10772
Pcdha1
Name: protocadherin alpha 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 116731
HGNC: HGNC:8663
Homologene: 75093
Frmd4a
Name: FERM domain containing 4A
Synonyms: C230040M21Rik, 2700017I06Rik, Gm13190
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209630
Homologene: 9971
Rfx4
Name: regulatory factor X, 4 (influences HLA class II expression)
Synonyms: 4933412G19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71137
HGNC: HGNC:9985
Homologene: 31119
Zkscan6
Name: zinc finger with KRAB and SCAN domains 6
Synonyms: 1700128E15Rik, KOX11, D11Ertd714e, Zfp535
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52712
Homologene: 12119
Cacna1e
Name: calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms: Cav2.3, Cchra1, alpha1E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12290
HGNC: HGNC:1392
Homologene: 20185
Ranbp3l
Name: RAN binding protein 3-like
Synonyms: C130037N17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223332
VEGA: 15
Homologene: 35407
Lrrtm2
Name: leucine rich repeat transmembrane neuronal 2
Synonyms: C630011A14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107065
VEGA: 18
Homologene: 65342
Agbl2
Name: ATP/GTP binding protein-like 2
Synonyms: A430081C19Rik, Ccp2, Ccp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271813
Homologene: 11715
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Or8j3c
Name: olfactory receptor family 8 subfamily J member 3C
Synonyms: GA_x6K02T2Q125-47892992-47892045, MOR185-1, Olfr1062
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259082
Homologene: 83135
Krt77
Name: keratin 77
Synonyms: 4732484G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406220
Homologene: 45490
Spata13
Name: spermatogenesis associated 13
Synonyms: ESTM11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219140
Homologene: 19482
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Zfp598
Name: zinc finger protein 598
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213753
VEGA: 17
Homologene: 5672
Accsl
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)-like
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381411
Homologene: 86007
Brinp2
Name: bone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms: 6430517E21Rik, Fam5b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240843
Homologene: 10905
Rabl2
Name: RAB, member RAS oncogene family-like 2
Synonyms: 1110031N17Rik, Rabl2a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68708
Homologene: 90913
Tmtc4
Name: transmembrane and tetratricopeptide repeat containing 4
Synonyms: 5730419O14Rik, 4930403J22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70551
Homologene: 32796
Pgm1
Name: phosphoglucomutase 1
Synonyms: Pgm-2, 2610020G18Rik, Pgm1a, Pgm2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72157
HGNC: HGNC:8905
Homologene: 1979
Slco4c1
Name: solute carrier organic anion transporter family, member 4C1
Synonyms: SLC21A20, PRO2176, OATP4C1, OATP-M1, OATP-H, C330017E21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227394
Homologene: 62654
Ppm1j
Name: protein phosphatase 1J
Synonyms: 2310008J22Rik, Ppp2cz, PP2Czeta
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71887
Homologene: 23632
Gbp9
Name: guanylate-binding protein 9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 236573
Homologene: 128731
Adh1
Name: alcohol dehydrogenase 1 (class I)
Synonyms: ADH-AA, class I alcohol dehydrogenase, Adh-1-t, Adh-1t, Adh-1, Adh1-t, Adh1-e, Adh1tl, Adh-1e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11522
Homologene: 73888
Lcn4
Name: lipocalin 4
Synonyms: Vnsp2, A630045M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16821
Homologene: 86960
Pou3f1
Name: POU domain, class 3, transcription factor 1
Synonyms: Scip, Tst-1, Test1, Otf6, Oct-6, Tst1, Oct6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18991
HGNC: HGNC:9214
Homologene: 20590
Or6ae1
Name: olfactory receptor family 6 subfamily AE member 1
Synonyms: GA_x6K02T2PBJ9-42315125-42314187, MOR103-5, Olfr522
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258954
Homologene: 62435
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, potassium channel Kv4.3L, Kv4.3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Wdr20rt
Name: WD repeat domain 20, retrogene
Synonyms: 4921538B03Rik, 4930427E19Rik, Wdr20b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70948
VEGA: 12
Tpra1
Name: transmembrane protein, adipocyte asscociated 1
Synonyms: Tpra40, 40kDa, Gpr175
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 24100
Homologene: 40799
Gnas
Name: GNAS complex locus
Synonyms: Gnas1, Gs-alpha, Gs alpha, G alpha s, Nesp55, P2, P3, P1, neuroendocrine-specific Golgi protein p55 isoform 1, XLalphas, Gsa, Nesp, Gnasxl, Nespl, Oedsml, Galphas, SCG6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14683
HGNC: HGNC:4392
Homologene: 55534
Ephb4
Name: Eph receptor B4
Synonyms: MDK2, Myk1, Htk, Tyro11, b2b2412Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Or4c12b
Name: olfactory receptor family 4 subfamily C member 12B
Synonyms: GA_x6K02T2Q125-51257221-51258135, MOR232-4, Olfr1255
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258979
Homologene: 82298
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Trafd1
Name: TRAF type zinc finger domain containing 1
Synonyms: 1110008K06Rik, Fln29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231712
Homologene: 31399
Or12e10
Name: olfactory receptor family 12 subfamily E member 10
Synonyms: GA_x6K02T2Q125-49311440-49312384, MOR264-19, Olfr1145
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258317
Homologene: 27123
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Thap7
Name: THAP domain containing 7
Synonyms: 1810004B07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69009
Homologene: 12293
Rnft1
Name: ring finger protein, transmembrane 1
Synonyms: 0610013E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76892
Homologene: 41110
Ctf1
Name: cardiotrophin 1
Synonyms: CT-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13019
HGNC: HGNC:2499
Homologene: 1016
Tas2r114
Name: taste receptor, type 2, member 114
Synonyms: Tas2r14, T2R14, mGR14, mt2r46
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387346
Homologene: 128355
Or8g18
Name: olfactory receptor family 8 subfamily G member 18
Synonyms: MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, K4, MOR171-41P, MOR171-32P, Olfr144, Olfr1537-ps1, Olfr1537
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257959
VEGA: 9
HGNC: HGNC:8484
Homologene: 110610
Or1e20-ps1
Name: olfactory receptor family 1 subfamily E member 20, pseudogene 1
Synonyms: GA_x6K02T2P1NL-3594531-3593598, MOR135-25, Olfr379-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257942
Vmn1r151
Name: vomeronasal 1 receptor 151
Synonyms: Gm5727
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435947
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 43,978,488 bp (GRCm38)
  • A to T, chromosome 1 at 96,871,918 bp (GRCm38)
  • T to A, chromosome 1 at 154,442,287 bp (GRCm38)
  • G to A, chromosome 1 at 158,246,703 bp (GRCm38)
  • A to T, chromosome 1 at 166,634,972 bp (GRCm38)
  • T to C, chromosome 2 at 4,603,900 bp (GRCm38)
  • C to T, chromosome 2 at 26,670,601 bp (GRCm38)
  • A to T, chromosome 2 at 86,423,363 bp (GRCm38)
  • T to A, chromosome 2 at 87,809,843 bp (GRCm38)
  • A to T, chromosome 2 at 89,817,209 bp (GRCm38)
  • T to C, chromosome 2 at 90,801,114 bp (GRCm38)
  • T to C, chromosome 2 at 93,869,153 bp (GRCm38)
  • T to C, chromosome 2 at 121,499,603 bp (GRCm38)
  • T to C, chromosome 2 at 174,343,296 bp (GRCm38)
  • T to C, chromosome 3 at 104,785,818 bp (GRCm38)
  • G to A, chromosome 3 at 105,665,547 bp (GRCm38)
  • T to A, chromosome 3 at 138,282,810 bp (GRCm38)
  • T to A, chromosome 4 at 99,984,045 bp (GRCm38)
  • G to A, chromosome 4 at 124,659,042 bp (GRCm38)
  • T to A, chromosome 4 at 144,333,108 bp (GRCm38)
  • C to T, chromosome 4 at 147,583,542 bp (GRCm38)
  • T to A, chromosome 5 at 21,375,792 bp (GRCm38)
  • T to C, chromosome 5 at 105,081,225 bp (GRCm38)
  • T to C, chromosome 5 at 121,378,774 bp (GRCm38)
  • T to A, chromosome 5 at 137,363,302 bp (GRCm38)
  • A to G, chromosome 5 at 137,577,507 bp (GRCm38)
  • G to C, chromosome 5 at 137,785,497 bp (GRCm38)
  • T to C, chromosome 6 at 42,305,528 bp (GRCm38)
  • T to C, chromosome 6 at 88,910,239 bp (GRCm38)
  • T to A, chromosome 6 at 107,568,544 bp (GRCm38)
  • T to A, chromosome 6 at 124,508,843 bp (GRCm38)
  • T to A, chromosome 6 at 131,689,783 bp (GRCm38)
  • T to A, chromosome 6 at 149,328,295 bp (GRCm38)
  • T to A, chromosome 6 at 149,512,893 bp (GRCm38)
  • T to A, chromosome 7 at 22,499,671 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to G, chromosome 7 at 35,776,148 bp (GRCm38)
  • G to T, chromosome 7 at 56,113,100 bp (GRCm38)
  • A to T, chromosome 7 at 70,360,308 bp (GRCm38)
  • T to C, chromosome 7 at 75,704,527 bp (GRCm38)
  • A to G, chromosome 7 at 98,097,611 bp (GRCm38)
  • T to A, chromosome 7 at 105,704,972 bp (GRCm38)
  • A to T, chromosome 7 at 114,232,197 bp (GRCm38)
  • T to A, chromosome 7 at 116,340,086 bp (GRCm38)
  • AGCAAC to A, chromosome 7 at 127,717,008 bp (GRCm38)
  • T to A, chromosome 7 at 140,162,909 bp (GRCm38)
  • A to T, chromosome 8 at 85,764,246 bp (GRCm38)
  • G to A, chromosome 8 at 110,595,482 bp (GRCm38)
  • G to T, chromosome 8 at 121,886,877 bp (GRCm38)
  • A to T, chromosome 9 at 14,614,767 bp (GRCm38)
  • A to G, chromosome 9 at 19,846,520 bp (GRCm38)
  • A to G, chromosome 9 at 26,883,787 bp (GRCm38)
  • T to C, chromosome 9 at 39,238,329 bp (GRCm38)
  • A to T, chromosome 9 at 100,497,316 bp (GRCm38)
  • T to A, chromosome 10 at 9,812,010 bp (GRCm38)
  • C to T, chromosome 10 at 60,331,216 bp (GRCm38)
  • T to A, chromosome 10 at 84,838,186 bp (GRCm38)
  • A to G, chromosome 10 at 116,302,237 bp (GRCm38)
  • T to A, chromosome 11 at 65,821,969 bp (GRCm38)
  • T to C, chromosome 11 at 73,047,901 bp (GRCm38)
  • T to A, chromosome 11 at 73,433,992 bp (GRCm38)
  • A to G, chromosome 11 at 77,974,583 bp (GRCm38)
  • T to G, chromosome 11 at 86,486,239 bp (GRCm38)
  • T to C, chromosome 12 at 51,769,296 bp (GRCm38)
  • A to G, chromosome 12 at 65,226,051 bp (GRCm38)
  • A to T, chromosome 13 at 67,669,516 bp (GRCm38)
  • T to A, chromosome 13 at 81,382,353 bp (GRCm38)
  • A to G, chromosome 13 at 100,690,367 bp (GRCm38)
  • T to A, chromosome 14 at 27,464,314 bp (GRCm38)
  • C to T, chromosome 14 at 60,692,400 bp (GRCm38)
  • G to A, chromosome 14 at 122,971,792 bp (GRCm38)
  • A to T, chromosome 15 at 9,007,302 bp (GRCm38)
  • T to C, chromosome 15 at 76,891,284 bp (GRCm38)
  • T to A, chromosome 15 at 89,590,428 bp (GRCm38)
  • A to T, chromosome 15 at 101,861,344 bp (GRCm38)
  • A to G, chromosome 16 at 17,530,288 bp (GRCm38)
  • G to T, chromosome 16 at 97,745,898 bp (GRCm38)
  • T to C, chromosome 16 at 97,806,504 bp (GRCm38)
  • A to G, chromosome 17 at 24,677,594 bp (GRCm38)
  • G to T, chromosome 17 at 46,258,807 bp (GRCm38)
  • A to G, chromosome 18 at 35,213,634 bp (GRCm38)
  • A to G, chromosome 18 at 36,932,233 bp (GRCm38)
  • A to G, chromosome 18 at 60,955,535 bp (GRCm38)
  • A to T, chromosome 18 at 78,856,566 bp (GRCm38)
  • T to C, chromosome 19 at 28,835,334 bp (GRCm38)
  • C to T, chromosome 19 at 46,068,061 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9513 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069315-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.