Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9542Btlr/Mmmh
Stock Number:
069341-MU
Citation ID:
RRID:MMRRC_069341-MU
Other Names:
R9542 (G1)
Major Collection:

Strain Information

Aven
Name: apoptosis, caspase activation inhibitor
Synonyms: 1700013A01Rik, mAven-S, mAven-L, 1700056A21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74268
Homologene: 10683
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Cdc42bpb
Name: CDC42 binding protein kinase beta
Synonyms: DMPK-like
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217866
VEGA: 12
HGNC: HGNC:1738
Homologene: 55945
Zmym4
Name: zinc finger, MYM-type 4
Synonyms: 6330503C17Rik, Zfp262
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67785
Homologene: 35470
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Actr2
Name: actin related protein 2
Synonyms: 4921510D23Rik, D6Ertd746e, Arp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66713
HGNC: HGNC:169
Homologene: 4181
Dis3
Name: DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms: 2810028N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72662
VEGA: 14
Homologene: 6910
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Pdcd6ip
Name: programmed cell death 6 interacting protein
Synonyms: Alix, AIP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18571
HGNC: HGNC:8766
Homologene: 22614
Acbd6
Name: acyl-Coenzyme A binding domain containing 6
Synonyms: 0610010G04Rik, 2610100E10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72482
Homologene: 12465
Rrp36
Name: ribosomal RNA processing 36
Synonyms: BC011248
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224823
VEGA: 17
Homologene: 40346
Atcay
Name: ataxia, cerebellar, Cayman type
Synonyms: 3322401A10Rik, BNIP-H, ji
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16467
HGNC: HGNC:779
Homologene: 13206
Pgr
Name: progesterone receptor
Synonyms: NR3C3, PR, 9930019P03Rik, PR-B, PR-A, ENSMUSG00000074510
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18667
HGNC: HGNC:8910
Homologene: 713
Cep63
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28135
Homologene: 11861
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Ccdc187
Name: coiled-coil domain containing 187
Synonyms: 4932418E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329366
Homologene: 77630
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: Hif1b, ESTM42, D3Ertd557e, bHLHe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Eif5b
Name: eukaryotic translation initiation factor 5B
Synonyms: IF2, A030003E17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226982
Homologene: 134613
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: 6720454P05Rik, BC002230
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217827
VEGA: 12
Homologene: 41213
Ncoa1
Name: nuclear receptor coactivator 1
Synonyms: SRC-a/NCoA-1, SRC-1, SRC1, steroid receptor coactivator-1, KAT13A, bHLHe74
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17977
VEGA: 12
HGNC: HGNC:7668
Homologene: 7859
Anxa9
Name: annexin A9
Synonyms: 2310069F17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71790
HGNC: HGNC:547
Homologene: 2643
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberin, Nafld, tuberous sclerosis 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Spata31
Name: spermatogenesis associated 31
Synonyms: 4930458L03Rik, Spata31a, Fam75a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78124
Homologene: 84621
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
BC024139
Name: cDNA sequence BC024139
Synonyms: 6230424I18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 271278
Homologene: 129974
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Pard3b
Name: par-3 family cell polarity regulator beta
Synonyms: 2810455B10Rik, PAR3beta, PAR3L, PAR3B, 2010002N16Rik, Als2cr19, 1810008K04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72823
Homologene: 35389
Or8h7
Name: olfactory receptor family 8 subfamily H member 7
Synonyms: GA_x6K02T2Q125-48376288-48375341, MOR206-2, Olfr1097
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258840
Homologene: 37005
Taok2
Name: TAO kinase 2
Synonyms: MAP3K17, TAO2, TAO1, PSK1, 1110033K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381921
Homologene: 74531
Trim67
Name: tripartite motif-containing 67
Synonyms: D130049O21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330863
Homologene: 45699
Acot12
Name: acyl-CoA thioesterase 12
Synonyms: 1300004O04Rik, 4930449F15Rik, Cach
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74156
Homologene: 12540
Slc28a2b
Name: solute carrier family 28 member 2b
Synonyms: Gm14085
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381417
Ss18l2
Name: SS18, nBAF chromatin remodeling complex subunit like 2
Synonyms: Band 47B, 1110020I04Rik, Deb1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26901
VEGA: 9
Homologene: 32307
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: semaphorin cytoplasmic domain-associated protein 3A, 1110020C07Rik, LNX3, Semcap3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Or52ad1
Name: olfactory receptor family 52 subfamily AD member 1
Synonyms: GA_x6K02T2PBJ9-6056235-6055291, MOR39-1, Olfr600
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259048
Homologene: 17476
Zfp687
Name: zinc finger protein 687
Synonyms: 4931408L03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78266
Homologene: 10827
Pfpl
Name: pore forming protein-like
Synonyms: Epcs5, Epcs50
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56093
VEGA: 19
Homologene: 130704
Urgcp
Name: upregulator of cell proliferation
Synonyms: 2010005J08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72046
Homologene: 69243
Ube2j1
Name: ubiquitin-conjugating enzyme E2J 1
Synonyms: 0710008M05Rik, Ncube, Ubc6p, 1110030I22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56228
Homologene: 41090
Nmur2
Name: neuromedin U receptor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216749
Homologene: 49618
Or2o1
Name: olfactory receptor family 2 subfamily O member 1
Synonyms: GA_x6K02T2QP88-6274566-6273628, MOR280-1, Olfr1394
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258273
Homologene: 138305
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434285
Serinc2
Name: serine incorporator 2
Synonyms: FKSG84, TDE2, 2310004K20Rik, Tde2l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230779
Homologene: 27797
Zfp119a
Name: zinc finger protein 119a
Synonyms: Mzf13, Zfp119
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 104349
Asic5
Name: acid-sensing ion channel family member 5
Synonyms: brain-liver-intestine amiloride-sensitive sodium channel, BLINaC, Accn5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58170
Homologene: 41171
Flacc1
Name: flagellum associated containing coiled-coil domains 1
Synonyms: 4933405P16Rik, 4933425F06Rik, Als2cr12
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108812
Homologene: 51399
Wdr38
Name: WD repeat domain 38
Synonyms: 1700123D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76646
Homologene: 79011
Vps9d1
Name: VPS9 domain containing 1
Synonyms: 2410004N05Rik, 1300018I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72325
Homologene: 21021
Rrp8
Name: ribosomal RNA processing 8
Synonyms: 2900001K19Rik, 1500003O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101867
Homologene: 5621
Trmt112
Name: tRNA methyltransferase 11-2
Synonyms: Trm112p, 0610038D11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67674
Homologene: 41132
Tmem18
Name: transmembrane protein 18
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211986
VEGA: 12
Homologene: 17675
Or2m12
Name: olfactory receptor family 2 subfamily M member 12
Synonyms: GA_x54KRFPKG5P-15738260-15737319, MOR279-2, Olfr164
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258443
Homologene: 51725
Serpinb9g
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms: ovalbumin, 1600002F03Rik, NK21B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 93806
HGNC: HGNC:8955
Homologene: 69093
Gm37240
Name: predicted gene, 37240
Type: Gene
Species: Mouse
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 20,117,780 bp (GRCm38)
  • G to T, chromosome 1 at 38,018,050 bp (GRCm38)
  • C to T, chromosome 1 at 58,678,345 bp (GRCm38)
  • C to T, chromosome 1 at 62,211,627 bp (GRCm38)
  • C to T, chromosome 1 at 75,422,782 bp (GRCm38)
  • T to A, chromosome 1 at 104,947,342 bp (GRCm38)
  • T to C, chromosome 1 at 155,567,610 bp (GRCm38)
  • C to T, chromosome 1 at 161,834,099 bp (GRCm38)
  • T to C, chromosome 1 at 162,680,790 bp (GRCm38)
  • T to C, chromosome 2 at 26,255,918 bp (GRCm38)
  • A to T, chromosome 2 at 39,000,198 bp (GRCm38)
  • T to C, chromosome 2 at 65,536,516 bp (GRCm38)
  • C to T, chromosome 2 at 76,885,013 bp (GRCm38)
  • G to T, chromosome 2 at 86,890,469 bp (GRCm38)
  • T to C, chromosome 2 at 112,625,172 bp (GRCm38)
  • A to T, chromosome 2 at 122,494,341 bp (GRCm38)
  • A to T, chromosome 3 at 82,004,543 bp (GRCm38)
  • A to C, chromosome 3 at 84,509,889 bp (GRCm38)
  • A to G, chromosome 3 at 89,043,259 bp (GRCm38)
  • C to T, chromosome 3 at 95,009,131 bp (GRCm38)
  • T to C, chromosome 3 at 95,303,068 bp (GRCm38)
  • C to T, chromosome 3 at 95,490,643 bp (GRCm38)
  • C to T, chromosome 3 at 107,458,255 bp (GRCm38)
  • G to T, chromosome 4 at 33,040,793 bp (GRCm38)
  • T to C, chromosome 4 at 126,905,371 bp (GRCm38)
  • C to T, chromosome 4 at 130,258,723 bp (GRCm38)
  • T to C, chromosome 4 at 144,330,525 bp (GRCm38)
  • C to G, chromosome 5 at 107,620,314 bp (GRCm38)
  • A to T, chromosome 6 at 101,172,274 bp (GRCm38)
  • T to C, chromosome 7 at 103,346,362 bp (GRCm38)
  • T to C, chromosome 7 at 105,733,399 bp (GRCm38)
  • A to T, chromosome 7 at 126,866,836 bp (GRCm38)
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp (GRCm38)
  • A to T, chromosome 8 at 123,243,783 bp (GRCm38)
  • A to G, chromosome 8 at 123,296,339 bp (GRCm38)
  • G to C, chromosome 8 at 124,794,758 bp (GRCm38)
  • G to T, chromosome 9 at 8,901,531 bp (GRCm38)
  • T to C, chromosome 9 at 102,607,334 bp (GRCm38)
  • T to C, chromosome 9 at 113,691,521 bp (GRCm38)
  • T to A, chromosome 9 at 121,712,600 bp (GRCm38)
  • G to A, chromosome 10 at 81,207,852 bp (GRCm38)
  • A to T, chromosome 11 at 5,717,517 bp (GRCm38)
  • C to T, chromosome 11 at 20,094,350 bp (GRCm38)
  • C to A, chromosome 11 at 49,160,246 bp (GRCm38)
  • T to C, chromosome 11 at 56,040,823 bp (GRCm38)
  • G to A, chromosome 11 at 67,181,176 bp (GRCm38)
  • T to G, chromosome 11 at 94,214,408 bp (GRCm38)
  • C to T, chromosome 12 at 4,275,178 bp (GRCm38)
  • G to A, chromosome 12 at 30,588,558 bp (GRCm38)
  • A to G, chromosome 12 at 100,144,167 bp (GRCm38)
  • G to A, chromosome 12 at 111,302,074 bp (GRCm38)
  • A to G, chromosome 13 at 33,495,158 bp (GRCm38)
  • A to T, chromosome 13 at 64,922,263 bp (GRCm38)
  • G to A, chromosome 13 at 91,782,991 bp (GRCm38)
  • A to G, chromosome 14 at 30,123,359 bp (GRCm38)
  • A to G, chromosome 14 at 99,079,539 bp (GRCm38)
  • A to G, chromosome 14 at 121,627,363 bp (GRCm38)
  • A to G, chromosome 15 at 44,546,888 bp (GRCm38)
  • T to A, chromosome 15 at 76,125,515 bp (GRCm38)
  • A to T, chromosome 16 at 19,286,193 bp (GRCm38)
  • C to T, chromosome 17 at 24,600,334 bp (GRCm38)
  • G to C, chromosome 17 at 46,672,566 bp (GRCm38)
  • G to A, chromosome 17 at 55,865,593 bp (GRCm38)
  • T to C, chromosome 17 at 57,225,037 bp (GRCm38)
  • A to G, chromosome 19 at 6,910,588 bp (GRCm38)
  • G to C, chromosome 19 at 12,428,933 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9542 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069341-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.