Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9542Btlr/Mmmh
Stock Number:
069341-MU
Citation ID:
RRID:MMRRC_069341-MU
Other Names:
R9542 (G1)
Major Collection:

Strain Information

Aven
Name: apoptosis, caspase activation inhibitor
Synonyms: 1700013A01Rik, mAven-S, mAven-L, 1700056A21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74268
Homologene: 10683
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Cdc42bpb
Name: CDC42 binding protein kinase beta
Synonyms: DMPK-like
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217866
VEGA: 12
HGNC: HGNC:1738
Homologene: 55945
Zmym4
Name: zinc finger, MYM-type 4
Synonyms: 6330503C17Rik, Zfp262
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67785
Homologene: 35470
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 20,117,780 bp (GRCm38)
  • G to T, chromosome 1 at 38,018,050 bp (GRCm38)
  • C to T, chromosome 1 at 58,678,345 bp (GRCm38)
  • C to T, chromosome 1 at 62,211,627 bp (GRCm38)
  • C to T, chromosome 1 at 75,422,782 bp (GRCm38)
  • T to A, chromosome 1 at 104,947,342 bp (GRCm38)
  • T to C, chromosome 1 at 155,567,610 bp (GRCm38)
  • C to T, chromosome 1 at 161,834,099 bp (GRCm38)
  • T to C, chromosome 1 at 162,680,790 bp (GRCm38)
  • T to C, chromosome 2 at 26,255,918 bp (GRCm38)
  • A to T, chromosome 2 at 39,000,198 bp (GRCm38)
  • T to C, chromosome 2 at 65,536,516 bp (GRCm38)
  • C to T, chromosome 2 at 76,885,013 bp (GRCm38)
  • G to T, chromosome 2 at 86,890,469 bp (GRCm38)
  • T to C, chromosome 2 at 112,625,172 bp (GRCm38)
  • A to T, chromosome 2 at 122,494,341 bp (GRCm38)
  • A to T, chromosome 3 at 82,004,543 bp (GRCm38)
  • A to C, chromosome 3 at 84,509,889 bp (GRCm38)
  • A to G, chromosome 3 at 89,043,259 bp (GRCm38)
  • C to T, chromosome 3 at 95,009,131 bp (GRCm38)
  • T to C, chromosome 3 at 95,303,068 bp (GRCm38)
  • C to T, chromosome 3 at 95,490,643 bp (GRCm38)
  • C to T, chromosome 3 at 107,458,255 bp (GRCm38)
  • G to T, chromosome 4 at 33,040,793 bp (GRCm38)
  • T to C, chromosome 4 at 126,905,371 bp (GRCm38)
  • C to T, chromosome 4 at 130,258,723 bp (GRCm38)
  • T to C, chromosome 4 at 144,330,525 bp (GRCm38)
  • C to G, chromosome 5 at 107,620,314 bp (GRCm38)
  • A to T, chromosome 6 at 101,172,274 bp (GRCm38)
  • T to C, chromosome 7 at 103,346,362 bp (GRCm38)
  • T to C, chromosome 7 at 105,733,399 bp (GRCm38)
  • A to T, chromosome 7 at 126,866,836 bp (GRCm38)
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp (GRCm38)
  • A to T, chromosome 8 at 123,243,783 bp (GRCm38)
  • A to G, chromosome 8 at 123,296,339 bp (GRCm38)
  • G to C, chromosome 8 at 124,794,758 bp (GRCm38)
  • G to T, chromosome 9 at 8,901,531 bp (GRCm38)
  • T to C, chromosome 9 at 102,607,334 bp (GRCm38)
  • T to C, chromosome 9 at 113,691,521 bp (GRCm38)
  • T to A, chromosome 9 at 121,712,600 bp (GRCm38)
  • G to A, chromosome 10 at 81,207,852 bp (GRCm38)
  • A to T, chromosome 11 at 5,717,517 bp (GRCm38)
  • C to T, chromosome 11 at 20,094,350 bp (GRCm38)
  • C to A, chromosome 11 at 49,160,246 bp (GRCm38)
  • T to C, chromosome 11 at 56,040,823 bp (GRCm38)
  • G to A, chromosome 11 at 67,181,176 bp (GRCm38)
  • T to G, chromosome 11 at 94,214,408 bp (GRCm38)
  • C to T, chromosome 12 at 4,275,178 bp (GRCm38)
  • G to A, chromosome 12 at 30,588,558 bp (GRCm38)
  • A to G, chromosome 12 at 100,144,167 bp (GRCm38)
  • G to A, chromosome 12 at 111,302,074 bp (GRCm38)
  • A to G, chromosome 13 at 33,495,158 bp (GRCm38)
  • A to T, chromosome 13 at 64,922,263 bp (GRCm38)
  • G to A, chromosome 13 at 91,782,991 bp (GRCm38)
  • A to G, chromosome 14 at 30,123,359 bp (GRCm38)
  • A to G, chromosome 14 at 99,079,539 bp (GRCm38)
  • A to G, chromosome 14 at 121,627,363 bp (GRCm38)
  • A to G, chromosome 15 at 44,546,888 bp (GRCm38)
  • T to A, chromosome 15 at 76,125,515 bp (GRCm38)
  • A to T, chromosome 16 at 19,286,193 bp (GRCm38)
  • C to T, chromosome 17 at 24,600,334 bp (GRCm38)
  • G to C, chromosome 17 at 46,672,566 bp (GRCm38)
  • G to A, chromosome 17 at 55,865,593 bp (GRCm38)
  • T to C, chromosome 17 at 57,225,037 bp (GRCm38)
  • A to G, chromosome 19 at 6,910,588 bp (GRCm38)
  • G to C, chromosome 19 at 12,428,933 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9542 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069341-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.