Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9552Btlr/Mmmh
Stock Number:
069348-MU
Citation ID:
RRID:MMRRC_069348-MU
Other Names:
R9552 (G1)
Major Collection:

Strain Information

Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Mark2
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Par-1, Emk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13728
HGNC: HGNC:3332
Homologene: 69013
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 66,678,123 bp (GRCm38)
  • T to A, chromosome 1 at 153,754,927 bp (GRCm38)
  • T to C, chromosome 1 at 167,378,302 bp (GRCm38)
  • T to C, chromosome 1 at 168,431,341 bp (GRCm38)
  • A to T, chromosome 1 at 174,137,319 bp (GRCm38)
  • A to T, chromosome 2 at 20,881,586 bp (GRCm38)
  • A to G, chromosome 2 at 72,178,217 bp (GRCm38)
  • C to T, chromosome 2 at 88,050,165 bp (GRCm38)
  • T to C, chromosome 2 at 104,471,505 bp (GRCm38)
  • T to C, chromosome 2 at 152,144,119 bp (GRCm38)
  • T to C, chromosome 3 at 75,323,624 bp (GRCm38)
  • T to C, chromosome 3 at 142,793,833 bp (GRCm38)
  • C to T, chromosome 4 at 96,227,603 bp (GRCm38)
  • C to T, chromosome 4 at 113,940,855 bp (GRCm38)
  • G to A, chromosome 4 at 134,202,001 bp (GRCm38)
  • G to A, chromosome 4 at 139,052,584 bp (GRCm38)
  • G to A, chromosome 5 at 31,466,332 bp (GRCm38)
  • A to G, chromosome 6 at 87,845,126 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to G, chromosome 7 at 12,305,673 bp (GRCm38)
  • A to T, chromosome 7 at 13,102,854 bp (GRCm38)
  • A to G, chromosome 7 at 27,459,361 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • C to A, chromosome 7 at 32,334,549 bp (GRCm38)
  • A to G, chromosome 7 at 33,279,773 bp (GRCm38)
  • G to T, chromosome 7 at 43,573,143 bp (GRCm38)
  • A to G, chromosome 7 at 45,008,927 bp (GRCm38)
  • A to G, chromosome 7 at 133,639,013 bp (GRCm38)
  • T to C, chromosome 7 at 138,394,269 bp (GRCm38)
  • T to G, chromosome 8 at 79,060,774 bp (GRCm38)
  • T to A, chromosome 8 at 82,334,548 bp (GRCm38)
  • T to C, chromosome 8 at 83,297,880 bp (GRCm38)
  • T to C, chromosome 9 at 36,734,379 bp (GRCm38)
  • A to G, chromosome 9 at 64,117,767 bp (GRCm38)
  • C to T, chromosome 9 at 103,222,084 bp (GRCm38)
  • A to T, chromosome 10 at 42,571,491 bp (GRCm38)
  • A to G, chromosome 11 at 31,360,332 bp (GRCm38)
  • G to A, chromosome 11 at 43,438,268 bp (GRCm38)
  • T to C, chromosome 12 at 74,976,560 bp (GRCm38)
  • AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA, chromosome 12 at 105,710,189 bp (GRCm38)
  • T to A, chromosome 13 at 13,502,460 bp (GRCm38)
  • A to G, chromosome 13 at 83,662,342 bp (GRCm38)
  • T to A, chromosome 14 at 4,635,265 bp (GRCm38)
  • T to C, chromosome 14 at 8,028,329 bp (GRCm38)
  • C to T, chromosome 14 at 32,562,568 bp (GRCm38)
  • T to A, chromosome 14 at 55,542,624 bp (GRCm38)
  • T to C, chromosome 14 at 55,713,476 bp (GRCm38)
  • C to T, chromosome 14 at 111,679,064 bp (GRCm38)
  • T to A, chromosome 15 at 48,791,960 bp (GRCm38)
  • T to C, chromosome 15 at 56,667,694 bp (GRCm38)
  • C to A, chromosome 15 at 98,772,832 bp (GRCm38)
  • A to T, chromosome 16 at 43,986,931 bp (GRCm38)
  • A to G, chromosome 16 at 85,802,617 bp (GRCm38)
  • T to C, chromosome 17 at 24,758,254 bp (GRCm38)
  • T to C, chromosome 17 at 74,499,029 bp (GRCm38)
  • T to A, chromosome 17 at 74,609,069 bp (GRCm38)
  • T to C, chromosome 17 at 90,630,022 bp (GRCm38)
  • G to T, chromosome 18 at 60,712,859 bp (GRCm38)
  • T to A, chromosome 18 at 69,956,042 bp (GRCm38)
  • G to T, chromosome 19 at 7,285,898 bp (GRCm38)
  • T to C, chromosome 19 at 39,183,802 bp (GRCm38)
  • G to A, chromosome 19 at 40,373,479 bp (GRCm38)
  • A to G, chromosome 19 at 42,731,317 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9552 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069348-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.