Strain Name:
C57BL/6J-MtgxR9552Btlr/Mmmh
Stock Number:
069348-MU
Citation ID:
RRID:MMRRC_069348-MU
Other Names:
R9552 (G1)
Major Collection:

Strain Information

Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Mark2
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Emk, Par-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13728
HGNC: HGNC:3332
Homologene: 69013
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: C130058G22Rik, CSB, CS group B correcting gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Pkn2
Name: protein kinase N2
Synonyms: 6030436C20Rik, Stk7, Prkcl2, PRK2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: Sh3d5, Ponsin, c-Cbl-associated protein, CAP, 9530001P15Rik, 2310065E01Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Zfp512
Name: zinc finger protein 512
Synonyms: 2500002M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269639
Homologene: 13026
Slu7
Name: SLU7 splicing factor homolog (S. cerevisiae)
Synonyms: D3Bwg0878e, D11Ertd730e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193116
Homologene: 4690
Slitrk5
Name: SLIT and NTRK-like family, member 5
Synonyms: 2610019D03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75409
VEGA: 14
Homologene: 9193
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22041
Homologene: 68153
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Ak7
Name: adenylate kinase 7
Synonyms: 4930502N02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78801
VEGA: 12
Homologene: 14268
Gramd1c
Name: GRAM domain containing 1C
Synonyms: 4921521N14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207798
Homologene: 129735
Lctl
Name: lactase-like
Synonyms: E130104I05Rik, KLPH
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235435
Homologene: 70710
Cnbp
Name: cellular nucleic acid binding protein
Synonyms: Znf9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12785
Homologene: 2567
Pbx1
Name: pre B cell leukemia homeobox 1
Synonyms: Pbx1b, D230003C07Rik, Pbx1a, Pbx-1, 2310056B04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18514
HGNC: HGNC:8632
Homologene: 20574
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214764
Homologene: 27985
Nr2e1
Name: nuclear receptor subfamily 2, group E, member 1
Synonyms: Nr2e1, tailless, Mtll, Tlx
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21907
HGNC: HGNC:7973
Homologene: 37750
Mgst3
Name: microsomal glutathione S-transferase 3
Synonyms: 2700004G04Rik, 2010306B17Rik, GST-III, 2010012L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66447
HGNC: HGNC:7064
Homologene: 3327
Il15
Name: interleukin 15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16168
HGNC: HGNC:5977
Homologene: 487
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: 5730402K07Rik, 1300003D15Rik, cAMP-GEFII, 6330581N18Rik, Epac2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Scaf1
Name: SR-related CTD-associated factor 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233208
Cyp2c66
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69888
Homologene: 133566
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Cyp2j7
Name: cytochrome P450, family 2, subfamily j, polypeptide 7
Synonyms: OTTMUSG00000007941, Cyp2j7-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 546837
HGNC: HGNC:2634
Stc2
Name: stanniocalcin 2
Synonyms: mustc2, Stc2l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20856
Homologene: 2753
Rnasel
Name: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms: E230029I04Rik, 2-5A-dependent RNAase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 24014
Homologene: 8040
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ucp1
Name: uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms: Slc25a7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22227
Homologene: 22524
Adamts1
Name: ADAM metallopeptidase with thrombospondin type 1 motif 1
Synonyms: METH-1, ADAM-TS1, METH1, ADAMTS-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11504
HGNC: HGNC:217
Homologene: 21381
Tmco4
Name: transmembrane and coiled-coil domains 4
Synonyms: 4632413C14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77056
Homologene: 57112
Nrxn1
Name: neurexin I
Synonyms: alpha-latrotoxin receptor (calcium-dependent), 1700062G21Rik, neurexin I alpha, 9330127H16Rik, neurexin I alpha, neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I beta, A230068P09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Zfp175
Name: zinc finger protein 175
Synonyms: Zfp658
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210104
Homologene: 134007
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Or6k4
Name: olfactory receptor family 6 subfamily K member 4
Synonyms: GA_x6K02T2P20D-21025190-21024243, MOR105-2, Olfr424
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258716
Homologene: 103798
Pck2
Name: phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms: 9130022B02Rik, 1810010O14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74551
VEGA: 14
HGNC: HGNC:8725
Homologene: 3356
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: TG K, TGase 1, K polypeptide, 2310004J08Rik, protein-glutamine-gamma-glutamyltransferase, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Or5d14
Name: olfactory receptor family 5 subfamily D member 14
Synonyms: MOR174-14, GA_x6K02T2Q125-49542541-49541597, Olfr1162
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258105
Homologene: 79476
Vmn1r86
Name: vomeronasal 1 receptor 86
Synonyms: Gm10301
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312473
Homologene: 74345
Stt3a
Name: STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
Synonyms: Itm1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16430
HGNC: HGNC:6172
Homologene: 40617
Nid1
Name: nidogen 1
Synonyms: entactin 1, entactin-1, entactin, nidogen-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Vmn1r82
Name: vomeronasal 1 receptor 82
Synonyms: V1rg12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171268
Hs3st6
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328779
VEGA: 17
Homologene: 84633
Pyroxd2
Name: pyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms: 4833409A17Rik, 3830409H07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74580
VEGA: 19
Homologene: 13097
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Ccdc68
Name: coiled-coil domain containing 68
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381175
Homologene: 11880
Zpld2
Name: zona pellucida like domain containing 2
Synonyms: Gm7534
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665186
Homologene: 104039
Zfp827
Name: zinc finger protein 827
Synonyms: D630040G17Rik, 2810449M09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622675
Homologene: 45622
Wnt10b
Name: wingless-type MMTV integration site family, member 10B
Synonyms: Wnt12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22410
VEGA: 15
Homologene: 20721
Ndst1
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms: glucosaminyl N-deacetylase/N-sulfotransferase 1, Ndst-1, Hsst, 1200015G06Rik, b2b2230Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15531
VEGA: 18
HGNC: HGNC:7680
Homologene: 20386
Blvrb
Name: biliverdin reductase B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233016
HGNC: HGNC:1063
Homologene: 573
Gm8159
Name: predicted gene 8159
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666549
Homologene: 115686
Yipf4
Name: Yip1 domain family, member 4
Synonyms: 2310034L04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67864
VEGA: 17
Homologene: 32658
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: HAI-2 related small protein, H2RSP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Abhd6
Name: abhydrolase domain containing 6
Synonyms: 0610041D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66082
VEGA: 14
Homologene: 23246
Tcf15
Name: transcription factor 15
Synonyms: paraxis, bHLH-EC2, Meso1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21407
Homologene: 37943
Scgb2b19
Name: secretoglobin, family 2B, member 19
Synonyms: Gm5894, Abpbg19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545947
Homologene: 83171
Wdr49
Name: WD repeat domain 49
Synonyms: EG213248
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213248
Homologene: 18714
Scgb1b12
Name: secretoglobin, family 1B, member 12
Synonyms: Abpa12, Gm9140
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668381
Homologene: 114479
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 66,678,123 bp (GRCm38)
  • T to A, chromosome 1 at 153,754,927 bp (GRCm38)
  • T to C, chromosome 1 at 167,378,302 bp (GRCm38)
  • T to C, chromosome 1 at 168,431,341 bp (GRCm38)
  • A to T, chromosome 1 at 174,137,319 bp (GRCm38)
  • A to T, chromosome 2 at 20,881,586 bp (GRCm38)
  • A to G, chromosome 2 at 72,178,217 bp (GRCm38)
  • C to T, chromosome 2 at 88,050,165 bp (GRCm38)
  • T to C, chromosome 2 at 104,471,505 bp (GRCm38)
  • T to C, chromosome 2 at 152,144,119 bp (GRCm38)
  • T to C, chromosome 3 at 75,323,624 bp (GRCm38)
  • T to C, chromosome 3 at 142,793,833 bp (GRCm38)
  • C to T, chromosome 4 at 96,227,603 bp (GRCm38)
  • C to T, chromosome 4 at 113,940,855 bp (GRCm38)
  • G to A, chromosome 4 at 134,202,001 bp (GRCm38)
  • G to A, chromosome 4 at 139,052,584 bp (GRCm38)
  • G to A, chromosome 5 at 31,466,332 bp (GRCm38)
  • A to G, chromosome 6 at 87,845,126 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to G, chromosome 7 at 12,305,673 bp (GRCm38)
  • A to T, chromosome 7 at 13,102,854 bp (GRCm38)
  • A to G, chromosome 7 at 27,459,361 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • C to A, chromosome 7 at 32,334,549 bp (GRCm38)
  • A to G, chromosome 7 at 33,279,773 bp (GRCm38)
  • G to T, chromosome 7 at 43,573,143 bp (GRCm38)
  • A to G, chromosome 7 at 45,008,927 bp (GRCm38)
  • A to G, chromosome 7 at 133,639,013 bp (GRCm38)
  • T to C, chromosome 7 at 138,394,269 bp (GRCm38)
  • T to G, chromosome 8 at 79,060,774 bp (GRCm38)
  • T to A, chromosome 8 at 82,334,548 bp (GRCm38)
  • T to C, chromosome 8 at 83,297,880 bp (GRCm38)
  • T to C, chromosome 9 at 36,734,379 bp (GRCm38)
  • A to G, chromosome 9 at 64,117,767 bp (GRCm38)
  • C to T, chromosome 9 at 103,222,084 bp (GRCm38)
  • A to T, chromosome 10 at 42,571,491 bp (GRCm38)
  • A to G, chromosome 11 at 31,360,332 bp (GRCm38)
  • G to A, chromosome 11 at 43,438,268 bp (GRCm38)
  • T to C, chromosome 12 at 74,976,560 bp (GRCm38)
  • AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA, chromosome 12 at 105,710,189 bp (GRCm38)
  • T to A, chromosome 13 at 13,502,460 bp (GRCm38)
  • A to G, chromosome 13 at 83,662,342 bp (GRCm38)
  • T to A, chromosome 14 at 4,635,265 bp (GRCm38)
  • T to C, chromosome 14 at 8,028,329 bp (GRCm38)
  • C to T, chromosome 14 at 32,562,568 bp (GRCm38)
  • T to A, chromosome 14 at 55,542,624 bp (GRCm38)
  • T to C, chromosome 14 at 55,713,476 bp (GRCm38)
  • C to T, chromosome 14 at 111,679,064 bp (GRCm38)
  • T to A, chromosome 15 at 48,791,960 bp (GRCm38)
  • T to C, chromosome 15 at 56,667,694 bp (GRCm38)
  • C to A, chromosome 15 at 98,772,832 bp (GRCm38)
  • A to T, chromosome 16 at 43,986,931 bp (GRCm38)
  • A to G, chromosome 16 at 85,802,617 bp (GRCm38)
  • T to C, chromosome 17 at 24,758,254 bp (GRCm38)
  • T to C, chromosome 17 at 74,499,029 bp (GRCm38)
  • T to A, chromosome 17 at 74,609,069 bp (GRCm38)
  • T to C, chromosome 17 at 90,630,022 bp (GRCm38)
  • G to T, chromosome 18 at 60,712,859 bp (GRCm38)
  • T to A, chromosome 18 at 69,956,042 bp (GRCm38)
  • G to T, chromosome 19 at 7,285,898 bp (GRCm38)
  • T to C, chromosome 19 at 39,183,802 bp (GRCm38)
  • G to A, chromosome 19 at 40,373,479 bp (GRCm38)
  • A to G, chromosome 19 at 42,731,317 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9552 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069348-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.