Strain Name:
C57BL/6J-MtgxR9564Btlr/Mmmh
Stock Number:
069358-MU
Citation ID:
RRID:MMRRC_069358-MU
Other Names:
R9564 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Mtmr3
Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Dennd2b
Name: DENN domain containing 2B
Synonyms: 2610305K15Rik, 2010004M01Rik, St5, Denn2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76954
Homologene: 3951
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, 4933438D16Rik, 4933439E17Rik, 4930513H15Rik, D14Ertd581e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101540
Homologene: 9516
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98732
Homologene: 40842
Ankib1
Name: ankyrin repeat and IBR domain containing 1
Synonyms: 2310061P20Rik, 4631416I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70797
Homologene: 19076
Copb1
Name: coatomer protein complex, subunit beta 1
Synonyms: Copb1, 2610019B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70349
HGNC: HGNC:2231
Homologene: 5664
2700097O09Rik
Name: RIKEN cDNA 2700097O09 gene
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72658
Homologene: 36458
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Stat3
Name: signal transducer and activator of transcription 3
Synonyms: Aprf, 1110034C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20848
Homologene: 7960
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Arfgef1
Name: ADP ribosylation factor guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Kank2
Name: KN motif and ankyrin repeat domains 2
Synonyms: Ankrd25
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235041
VEGA: 9
Homologene: 9163
Slc12a3
Name: solute carrier family 12, member 3
Synonyms: NCC, TSC
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20497
Homologene: 287
Gas8
Name: growth arrest specific 8
Synonyms: Gas11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104346
HGNC: HGNC:4166
Homologene: 1135
Rpl27a
Name: ribosomal protein L27A
Synonyms: L27A, ribosomal protein L29 homolog (yeast), L27'
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26451
Homologene: 115477
Psip1
Name: PC4 and SFRS1 interacting protein 1
Synonyms: Psip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 101739
HGNC: HGNC:9527
Homologene: 13242
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Rab3ip
Name: RAB3A interacting protein
Synonyms: Gtpat12, SSX2 interacting protein, Rabin3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216363
VEGA: 10
Homologene: 32340
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Bdkrb1
Name: bradykinin receptor, beta 1
Synonyms: kinin B1, B1R
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12061
HGNC: HGNC:1029
Homologene: 570
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Atf7
Name: activating transcription factor 7
Synonyms: C130020M04Rik, 1110012F10Rik, 9430065F09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223922
HGNC: HGNC:792
Homologene: 4994
Ctdsp2
Name: CTD small phosphatase 2
Synonyms: SCP2, OS4, D10Ertd73e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52468
VEGA: 10
Homologene: 128791
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74342
Homologene: 41763
Acsf2
Name: acyl-CoA synthetase family member 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 264895
Homologene: 23519
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Copg1
Name: coatomer protein complex, subunit gamma 1
Synonyms: D6Ertd71e, D6Wsu16e, Copg
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54161
HGNC: HGNC:2236
Homologene: 56745
Lrrc40
Name: leucine rich repeat containing 40
Synonyms: 2610040E16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67144
Homologene: 9825
Trim33
Name: tripartite motif-containing 33
Synonyms: Tif1g, 8030451N04Rik, ectodermin, Ecto
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Ric3
Name: RIC3 acetylcholine receptor chaperone
Synonyms: E130307J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320360
Homologene: 49772
Tmem207
Name: transmembrane protein 207
Synonyms: LOC224058, 100043057
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100043057
VEGA: 16
Homologene: 52611
Zfp808
Name: zinc finger protein 808
Synonyms: Gm7036
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 630579
Homologene: 134631
Skor2
Name: SKI family transcriptional corepressor 2
Synonyms: Fussel18, Corl2, Gm7348
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 664805
VEGA: 18
Homologene: 64797
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Nr4a2
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: HZF-3, RNR-1, Nurr1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18227
HGNC: HGNC:7981
Homologene: 4509
Skic2
Name: SKI2 subunit of superkiller complex
Synonyms: Ski2w, 4930534J06Rik, Skiv2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 108077
Homologene: 123971
Tek
Name: TEK receptor tyrosine kinase
Synonyms: Hyk, Tie2, Cd202b, tie-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: 9330101J02Rik, Ttc40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1537Clo, b2b1565Clo, b2b1154Clo, b2b1134Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Asic3
Name: acid-sensing ion channel 3
Synonyms: DRASIC, Accn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 171209
HGNC: HGNC:101
Homologene: 20999
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Degs1l
Name: delta 4-desaturase, sphingolipid 1 like
Synonyms: 9130409I23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 619326
Homologene: 134522
Hmox2
Name: heme oxygenase 2
Synonyms: HO-2, HO2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15369
HGNC: HGNC:5014
Homologene: 1611
Plekhs1
Name: pleckstrin homology domain containing, family S member 1
Synonyms: 9930023K05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226245
VEGA: 19
Homologene: 11770
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Ikzf3
Name: IKAROS family zinc finger 3
Synonyms: Aiolos, 5830411O07Rik, Zfpn1a3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22780
Homologene: 8269
3110009E18Rik
Name: RIKEN cDNA 3110009E18 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73103
Homologene: 41754
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: LOC380730, Gm884
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Pold2
Name: polymerase (DNA directed), delta 2, regulatory subunit
Synonyms: p50, po1D2, 50kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18972
HGNC: HGNC:9176
Homologene: 4538
Entpd7
Name: ectonucleoside triphosphate diphosphohydrolase 7
Synonyms: LALP1, 2810003F23Rik, 1810020C02Rik, Lysal2, 1810012B13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 93685
Homologene: 122202
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Btn2a2
Name: butyrophilin, subfamily 2, member A2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238555
Homologene: 56012
Vmn1r208
Name: vomeronasal 1 receptor 208
Synonyms: V1rh9, Vmn1r208-ps
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171252
Homologene: 110880
Trpm8
Name: transient receptor potential cation channel, subfamily M, member 8
Synonyms: CMR1, TRPP8, Trp-p8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171382
Homologene: 23433
Topaz1
Name: testis and ovary specific PAZ domain containing 1
Synonyms: Gm9524
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671232
VEGA: 9
Homologene: 19835
Osbpl6
Name: oxysterol binding protein-like 6
Synonyms: ORP-6, 1110062M20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99031
Homologene: 101447
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50720
Bcl9l
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80288
VEGA: 9
Homologene: 65615
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17836
HGNC: HGNC:9750
Homologene: 136663
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Rtl1
Name: retrotransposon Gaglike 1
Synonyms: Mart1, Mor1, Mar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 353326
VEGA: 12
Homologene: 120261
Akt3
Name: thymoma viral proto-oncogene 3
Synonyms: PKB gamma, D930002M15Rik, Nmf350
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23797
HGNC: HGNC:393
Homologene: 55904
Lmntd2
Name: lamin tail domain containing 2
Synonyms: 1600016N20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72000
Homologene: 104159
Coil
Name: coilin
Synonyms: p80-coilin, Cln80
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12812
HGNC: HGNC:2184
Homologene: 3413
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, VEGFR-2, vascular endothelial growth factor receptor- 2, VEGFR2, Flk-1, Flk1, orv
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Prss28
Name: serine protease 28
Synonyms: mIsp-1, Isp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 114661
Homologene: 130906
Ctla2b
Name: cytotoxic T lymphocyte-associated protein 2 beta
Synonyms: Ctla-2b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13025
VEGA: 13
Homologene: 130627
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Enthd1
Name: ENTH domain containing 1
Synonyms: LOC383075
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 383075
VEGA: 15
Homologene: 45131
Wiz
Name: widely-interspaced zinc finger motifs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22404
Homologene: 7997
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: 5730421J18Rik, 5730538E15Rik, Vcip135
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Spata32
Name: spermatogenesis associated 32
Synonyms: 4933400C05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 328019
Homologene: 17554
Ccdc154
Name: coiled-coil domain containing 154
Synonyms: LOC207209, ntl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207209
Homologene: 19361
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Cpt1b
Name: carnitine palmitoyltransferase 1b, muscle
Synonyms: M-CPTI, M-CPT I, Cpt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12895
HGNC: HGNC:2329
Homologene: 22548
Or7g18
Name: olfactory receptor family 7 subfamily G member 18
Synonyms: GA_x6K02T2PVTD-12618399-12619337, MOR152-1, Olfr830
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258559
HGNC: HGNC:8466
Homologene: 79360
Adam21
Name: a disintegrin and metallopeptidase domain 21
Synonyms: ADAM31
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56622
HGNC: HGNC:200
Homologene: 68365
Lvrn
Name: laeverin
Synonyms: 4833403I15Rik, Aqpep
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74574
VEGA: 18
Homologene: 51352
Zpld1
Name: zona pellucida like domain containing 1
Synonyms: 9430016A21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239852
Homologene: 18401
Fbxw17
Name: F-box and WD-40 domain protein 17
Synonyms: 1110064L07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109082
Homologene: 82571
Or6c33
Name: olfactory receptor family 6 subfamily C member 33
Synonyms: GA_x6K02T2PULF-11688441-11689379, MOR116-1, Olfr820
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258670
Homologene: 17337
Vmn1r74
Name: vomeronasal 1 receptor 74
Synonyms: V1rg5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171240
Homologene: 110796
Btnl10
Name: butyrophilin-like 10
Synonyms: BUTR-1, Butr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192194
Homologene: 138184
Map3k3
Name: mitogen-activated protein kinase kinase kinase 3
Synonyms: MAPKKK3, Mekk3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26406
HGNC: HGNC:6855
Homologene: 69110
Dlgap1
Name: DLG associated protein 1
Synonyms: SAPAP1, DAP-1 beta, D17Bwg0511e, GKAP/SAPAP, Sapap1, 4933422O14Rik, Gkap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Pcdhb21
Name: protocadherin beta 21
Synonyms: Pcdhb18, PcdhbU
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93892
Homologene: 134302
Ehd3
Name: EH-domain containing 3
Synonyms: Ehd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57440
HGNC: HGNC:3244
Homologene: 81837
Zfp760
Name: zinc finger protein 760
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240034
VEGA: 17
Ddi1
Name: DNA-damage inducible 1
Synonyms: 1700011N24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71829
VEGA: 9
Homologene: 100549
Mstn
Name: myostatin
Synonyms: Gdf8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17700
HGNC: HGNC:4223
Homologene: 3850
Zfp78
Name: zinc finger protein 78
Synonyms: KRAB12, Zfp77
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330463
Homologene: 128524
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Cd300ld2
Name: CD300 molecule like family member D2
Synonyms: Gm11709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629970
Actr5
Name: ARP5 actin-related protein 5
Synonyms: B430109J19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109275
Homologene: 6818
Telo2
Name: telomere maintenance 2
Synonyms: 1200003M09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71718
Homologene: 41107
Rarres2
Name: retinoic acid receptor responder (tazarotene induced) 2
Synonyms: 0610007L05Rik, chemerin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71660
HGNC: HGNC:9868
Homologene: 2167
Gdf9
Name: growth differentiation factor 9
Synonyms: Gdf-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14566
HGNC: HGNC:4224
Homologene: 3851
Mkx
Name: mohawk homeobox
Synonyms: Irxl1, 9430023B20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 210719
Homologene: 72239
AI429214
Name: expressed sequence AI429214
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 621080
Homologene: 82747
Rptn
Name: repetin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20129
Homologene: 84780
Vmn2r33
Name: vomeronasal 2, receptor 33
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 624512
Homologene: 113703
Serpina3a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms: 4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74069
HGNC: HGNC:16
C1qtnf12
Name: C1q and tumor necrosis factor related 12
Synonyms: 1110035L05Rik, C1qdc2, alipolin, Fam132a, adipolin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67389
Homologene: 12123
Gm15922
Name: predicted gene 15922
Type: Gene
Species: Mouse
Chromosome: 7
Or2d3c
Name: olfactory receptor family 2 subfamily D member 3C
Synonyms: GA_x6K02T2PBJ9-9307730-9306814, MOR260-7, Olfr709
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258146
Arpc5l
Name: actin related protein 2/3 complex, subunit 5-like
Synonyms: ARC16-2, 2010015J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74192
Homologene: 36463
St6galnac5
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Synonyms: ST6GalNAc V, Siat7e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26938
Homologene: 8079
Sec61b
Name: SEC61 translocon subunit beta
Synonyms: 1190006C12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66212
Homologene: 38229
Pomc
Name: pro-opiomelanocortin-alpha
Synonyms: POMC, Pomc-1, alpha-MSH, alpha-melanocyte stimulating hormone, adrenal corticotropic hormone, ACTH, gamma-melanocyte stimulating hormone, beta-melanocyte stimulating hormone, gamma-MSH, beta-MSH, alphaMSH, BE, beta-endorphin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18976
VEGA: 12
HGNC: HGNC:9201
Homologene: 723
Fadd
Name: Fas associated via death domain
Synonyms: Mort1/FADD
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14082
HGNC: HGNC:3573
Homologene: 2836
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 9,747,231 bp (GRCm38)
  • A to T, chromosome 1 at 10,147,533 bp (GRCm38)
  • T to A, chromosome 1 at 53,064,208 bp (GRCm38)
  • T to A, chromosome 1 at 67,158,889 bp (GRCm38)
  • A to G, chromosome 1 at 88,326,436 bp (GRCm38)
  • T to A, chromosome 1 at 120,169,276 bp (GRCm38)
  • G to A, chromosome 1 at 132,434,285 bp (GRCm38)
  • T to C, chromosome 1 at 136,118,778 bp (GRCm38)
  • T to C, chromosome 1 at 162,958,452 bp (GRCm38)
  • T to C, chromosome 1 at 177,080,203 bp (GRCm38)
  • G to T, chromosome 1 at 181,055,245 bp (GRCm38)
  • A to G, chromosome 1 at 185,282,494 bp (GRCm38)
  • T to C, chromosome 1 at 188,536,354 bp (GRCm38)
  • A to G, chromosome 2 at 14,261,306 bp (GRCm38)
  • A to G, chromosome 2 at 39,015,112 bp (GRCm38)
  • A to T, chromosome 2 at 57,110,178 bp (GRCm38)
  • T to A, chromosome 2 at 76,595,977 bp (GRCm38)
  • T to C, chromosome 2 at 76,749,986 bp (GRCm38)
  • A to G, chromosome 2 at 158,628,215 bp (GRCm38)
  • A to G, chromosome 3 at 93,397,229 bp (GRCm38)
  • T to A, chromosome 3 at 103,331,649 bp (GRCm38)
  • T to C, chromosome 3 at 108,414,518 bp (GRCm38)
  • T to C, chromosome 3 at 152,840,145 bp (GRCm38)
  • T to A, chromosome 3 at 158,040,441 bp (GRCm38)
  • A to G, chromosome 4 at 47,483,049 bp (GRCm38)
  • T to C, chromosome 4 at 83,468,651 bp (GRCm38)
  • C to A, chromosome 4 at 94,873,935 bp (GRCm38)
  • A to G, chromosome 4 at 96,526,008 bp (GRCm38)
  • C to T, chromosome 4 at 155,965,016 bp (GRCm38)
  • T to A, chromosome 5 at 3,755,733 bp (GRCm38)
  • C to G, chromosome 5 at 24,415,877 bp (GRCm38)
  • T to A, chromosome 5 at 75,964,905 bp (GRCm38)
  • T to C, chromosome 5 at 137,406,426 bp (GRCm38)
  • T to A, chromosome 6 at 17,531,426 bp (GRCm38)
  • C to T, chromosome 6 at 48,572,230 bp (GRCm38)
  • A to G, chromosome 6 at 77,244,553 bp (GRCm38)
  • T to G, chromosome 6 at 87,892,701 bp (GRCm38)
  • G to A, chromosome 6 at 121,884,628 bp (GRCm38)
  • C to T, chromosome 7 at 3,739,647 bp (GRCm38)
  • A to G, chromosome 7 at 6,378,391 bp (GRCm38)
  • T to C, chromosome 7 at 7,554,082 bp (GRCm38)
  • T to C, chromosome 7 at 10,171,255 bp (GRCm38)
  • T to C, chromosome 7 at 11,847,607 bp (GRCm38)
  • C to A, chromosome 7 at 16,857,819 bp (GRCm38)
  • T to G, chromosome 7 at 27,418,079 bp (GRCm38)
  • A to G, chromosome 7 at 64,349,492 bp (GRCm38)
  • T to C, chromosome 7 at 75,609,413 bp (GRCm38)
  • A to G, chromosome 7 at 106,926,640 bp (GRCm38)
  • A to G, chromosome 7 at 109,038,811 bp (GRCm38)
  • C to A, chromosome 7 at 109,519,630 bp (GRCm38)
  • G to T, chromosome 7 at 109,526,329 bp (GRCm38)
  • A to G, chromosome 7 at 114,236,799 bp (GRCm38)
  • A to G, chromosome 7 at 118,212,985 bp (GRCm38)
  • A to T, chromosome 7 at 139,651,555 bp (GRCm38)
  • A to G, chromosome 7 at 141,210,788 bp (GRCm38)
  • A to T, chromosome 7 at 144,582,311 bp (GRCm38)
  • A to G, chromosome 8 at 36,993,913 bp (GRCm38)
  • TGG to TG, chromosome 8 at 88,326,425 bp (GRCm38)
  • G to A, chromosome 8 at 94,356,355 bp (GRCm38)
  • T to A, chromosome 8 at 123,536,440 bp (GRCm38)
  • T to A, chromosome 9 at 6,265,730 bp (GRCm38)
  • T to C, chromosome 9 at 14,562,217 bp (GRCm38)
  • G to A, chromosome 9 at 18,875,344 bp (GRCm38)
  • T to C, chromosome 9 at 21,794,556 bp (GRCm38)
  • A to G, chromosome 9 at 21,795,335 bp (GRCm38)
  • A to G, chromosome 9 at 37,429,604 bp (GRCm38)
  • A to G, chromosome 9 at 42,046,597 bp (GRCm38)
  • T to A, chromosome 9 at 42,337,827 bp (GRCm38)
  • A to G, chromosome 9 at 44,509,257 bp (GRCm38)
  • AAGAGAG to AAGAG, chromosome 9 at 51,850,113 bp (GRCm38)
  • T to A, chromosome 9 at 72,858,871 bp (GRCm38)
  • C to T, chromosome 9 at 122,750,154 bp (GRCm38)
  • A to G, chromosome 10 at 41,285,391 bp (GRCm38)
  • C to T, chromosome 10 at 53,630,008 bp (GRCm38)
  • A to T, chromosome 10 at 116,915,875 bp (GRCm38)
  • A to G, chromosome 10 at 126,996,171 bp (GRCm38)
  • T to C, chromosome 10 at 130,017,418 bp (GRCm38)
  • A to T, chromosome 11 at 4,490,992 bp (GRCm38)
  • C to T, chromosome 11 at 5,874,163 bp (GRCm38)
  • T to A, chromosome 11 at 53,436,684 bp (GRCm38)
  • T to A, chromosome 11 at 58,922,363 bp (GRCm38)
  • T to C, chromosome 11 at 67,286,389 bp (GRCm38)
  • T to A, chromosome 11 at 88,981,800 bp (GRCm38)
  • T to A, chromosome 11 at 94,573,065 bp (GRCm38)
  • T to A, chromosome 11 at 98,467,206 bp (GRCm38)
  • T to C, chromosome 11 at 100,893,788 bp (GRCm38)
  • T to A, chromosome 11 at 103,208,953 bp (GRCm38)
  • T to C, chromosome 11 at 103,612,996 bp (GRCm38)
  • T to A, chromosome 11 at 106,151,034 bp (GRCm38)
  • T to A, chromosome 11 at 110,074,184 bp (GRCm38)
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp (GRCm38)
  • A to G, chromosome 12 at 3,959,971 bp (GRCm38)
  • A to T, chromosome 12 at 55,057,305 bp (GRCm38)
  • C to T, chromosome 12 at 81,559,059 bp (GRCm38)
  • C to T, chromosome 12 at 85,044,402 bp (GRCm38)
  • A to T, chromosome 12 at 104,118,627 bp (GRCm38)
  • G to A, chromosome 12 at 105,604,819 bp (GRCm38)
  • G to T, chromosome 12 at 109,590,279 bp (GRCm38)
  • A to G, chromosome 13 at 22,772,619 bp (GRCm38)
  • C to A, chromosome 13 at 23,478,678 bp (GRCm38)
  • T to C, chromosome 13 at 50,425,569 bp (GRCm38)
  • A to T, chromosome 13 at 60,896,042 bp (GRCm38)
  • T to A, chromosome 13 at 62,172,847 bp (GRCm38)
  • A to G, chromosome 14 at 33,955,520 bp (GRCm38)
  • T to A, chromosome 14 at 61,211,597 bp (GRCm38)
  • G to T, chromosome 14 at 99,137,174 bp (GRCm38)
  • G to A, chromosome 15 at 28,290,276 bp (GRCm38)
  • G to T, chromosome 15 at 80,560,034 bp (GRCm38)
  • A to T, chromosome 15 at 89,419,269 bp (GRCm38)
  • T to A, chromosome 15 at 102,534,277 bp (GRCm38)
  • A to G, chromosome 16 at 4,765,006 bp (GRCm38)
  • G to T, chromosome 16 at 26,516,749 bp (GRCm38)
  • T to A, chromosome 16 at 55,241,338 bp (GRCm38)
  • T to C, chromosome 16 at 94,134,721 bp (GRCm38)
  • T to A, chromosome 16 at 94,448,059 bp (GRCm38)
  • T to G, chromosome 17 at 21,723,291 bp (GRCm38)
  • A to G, chromosome 17 at 25,115,225 bp (GRCm38)
  • C to A, chromosome 17 at 25,168,407 bp (GRCm38)
  • C to T, chromosome 17 at 25,309,937 bp (GRCm38)
  • T to G, chromosome 17 at 28,807,178 bp (GRCm38)
  • T to A, chromosome 17 at 30,713,047 bp (GRCm38)
  • G to T, chromosome 17 at 32,356,965 bp (GRCm38)
  • C to T, chromosome 17 at 34,844,782 bp (GRCm38)
  • A to G, chromosome 17 at 55,662,465 bp (GRCm38)
  • T to G, chromosome 17 at 70,657,463 bp (GRCm38)
  • T to G, chromosome 17 at 73,830,366 bp (GRCm38)
  • A to G, chromosome 18 at 7,002,457 bp (GRCm38)
  • T to C, chromosome 18 at 37,513,919 bp (GRCm38)
  • T to G, chromosome 18 at 46,884,439 bp (GRCm38)
  • C to T, chromosome 18 at 65,305,943 bp (GRCm38)
  • C to T, chromosome 18 at 76,858,681 bp (GRCm38)
  • A to G, chromosome 19 at 6,509,857 bp (GRCm38)
  • A to G, chromosome 19 at 18,873,876 bp (GRCm38)
  • T to A, chromosome 19 at 41,603,422 bp (GRCm38)
  • A to G, chromosome 19 at 43,717,450 bp (GRCm38)
  • A to T, chromosome 19 at 56,473,196 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9564 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069358-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.