Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9564Btlr/Mmmh
Stock Number:
069358-MU
Citation ID:
RRID:MMRRC_069358-MU
Other Names:
R9564 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Mtmr3
Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Dennd2b
Name: DENN domain containing 2B
Synonyms: 2610305K15Rik, 2010004M01Rik, St5, Denn2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76954
Homologene: 3951
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 9,747,231 bp (GRCm38)
  • A to T, chromosome 1 at 10,147,533 bp (GRCm38)
  • T to A, chromosome 1 at 53,064,208 bp (GRCm38)
  • T to A, chromosome 1 at 67,158,889 bp (GRCm38)
  • A to G, chromosome 1 at 88,326,436 bp (GRCm38)
  • T to A, chromosome 1 at 120,169,276 bp (GRCm38)
  • G to A, chromosome 1 at 132,434,285 bp (GRCm38)
  • T to C, chromosome 1 at 136,118,778 bp (GRCm38)
  • T to C, chromosome 1 at 162,958,452 bp (GRCm38)
  • T to C, chromosome 1 at 177,080,203 bp (GRCm38)
  • G to T, chromosome 1 at 181,055,245 bp (GRCm38)
  • A to G, chromosome 1 at 185,282,494 bp (GRCm38)
  • T to C, chromosome 1 at 188,536,354 bp (GRCm38)
  • A to G, chromosome 2 at 14,261,306 bp (GRCm38)
  • A to G, chromosome 2 at 39,015,112 bp (GRCm38)
  • A to T, chromosome 2 at 57,110,178 bp (GRCm38)
  • T to A, chromosome 2 at 76,595,977 bp (GRCm38)
  • T to C, chromosome 2 at 76,749,986 bp (GRCm38)
  • A to G, chromosome 2 at 158,628,215 bp (GRCm38)
  • A to G, chromosome 3 at 93,397,229 bp (GRCm38)
  • T to A, chromosome 3 at 103,331,649 bp (GRCm38)
  • T to C, chromosome 3 at 108,414,518 bp (GRCm38)
  • T to C, chromosome 3 at 152,840,145 bp (GRCm38)
  • T to A, chromosome 3 at 158,040,441 bp (GRCm38)
  • A to G, chromosome 4 at 47,483,049 bp (GRCm38)
  • T to C, chromosome 4 at 83,468,651 bp (GRCm38)
  • C to A, chromosome 4 at 94,873,935 bp (GRCm38)
  • A to G, chromosome 4 at 96,526,008 bp (GRCm38)
  • C to T, chromosome 4 at 155,965,016 bp (GRCm38)
  • T to A, chromosome 5 at 3,755,733 bp (GRCm38)
  • C to G, chromosome 5 at 24,415,877 bp (GRCm38)
  • T to A, chromosome 5 at 75,964,905 bp (GRCm38)
  • T to C, chromosome 5 at 137,406,426 bp (GRCm38)
  • T to A, chromosome 6 at 17,531,426 bp (GRCm38)
  • C to T, chromosome 6 at 48,572,230 bp (GRCm38)
  • A to G, chromosome 6 at 77,244,553 bp (GRCm38)
  • T to G, chromosome 6 at 87,892,701 bp (GRCm38)
  • G to A, chromosome 6 at 121,884,628 bp (GRCm38)
  • C to T, chromosome 7 at 3,739,647 bp (GRCm38)
  • A to G, chromosome 7 at 6,378,391 bp (GRCm38)
  • T to C, chromosome 7 at 7,554,082 bp (GRCm38)
  • T to C, chromosome 7 at 10,171,255 bp (GRCm38)
  • T to C, chromosome 7 at 11,847,607 bp (GRCm38)
  • C to A, chromosome 7 at 16,857,819 bp (GRCm38)
  • T to G, chromosome 7 at 27,418,079 bp (GRCm38)
  • A to G, chromosome 7 at 64,349,492 bp (GRCm38)
  • T to C, chromosome 7 at 75,609,413 bp (GRCm38)
  • A to G, chromosome 7 at 106,926,640 bp (GRCm38)
  • A to G, chromosome 7 at 109,038,811 bp (GRCm38)
  • C to A, chromosome 7 at 109,519,630 bp (GRCm38)
  • G to T, chromosome 7 at 109,526,329 bp (GRCm38)
  • A to G, chromosome 7 at 114,236,799 bp (GRCm38)
  • A to G, chromosome 7 at 118,212,985 bp (GRCm38)
  • A to T, chromosome 7 at 139,651,555 bp (GRCm38)
  • A to G, chromosome 7 at 141,210,788 bp (GRCm38)
  • A to T, chromosome 7 at 144,582,311 bp (GRCm38)
  • A to G, chromosome 8 at 36,993,913 bp (GRCm38)
  • TGG to TG, chromosome 8 at 88,326,425 bp (GRCm38)
  • G to A, chromosome 8 at 94,356,355 bp (GRCm38)
  • T to A, chromosome 8 at 123,536,440 bp (GRCm38)
  • T to A, chromosome 9 at 6,265,730 bp (GRCm38)
  • T to C, chromosome 9 at 14,562,217 bp (GRCm38)
  • G to A, chromosome 9 at 18,875,344 bp (GRCm38)
  • T to C, chromosome 9 at 21,794,556 bp (GRCm38)
  • A to G, chromosome 9 at 21,795,335 bp (GRCm38)
  • A to G, chromosome 9 at 37,429,604 bp (GRCm38)
  • A to G, chromosome 9 at 42,046,597 bp (GRCm38)
  • T to A, chromosome 9 at 42,337,827 bp (GRCm38)
  • A to G, chromosome 9 at 44,509,257 bp (GRCm38)
  • AAGAGAG to AAGAG, chromosome 9 at 51,850,113 bp (GRCm38)
  • T to A, chromosome 9 at 72,858,871 bp (GRCm38)
  • C to T, chromosome 9 at 122,750,154 bp (GRCm38)
  • A to G, chromosome 10 at 41,285,391 bp (GRCm38)
  • C to T, chromosome 10 at 53,630,008 bp (GRCm38)
  • A to T, chromosome 10 at 116,915,875 bp (GRCm38)
  • A to G, chromosome 10 at 126,996,171 bp (GRCm38)
  • T to C, chromosome 10 at 130,017,418 bp (GRCm38)
  • A to T, chromosome 11 at 4,490,992 bp (GRCm38)
  • C to T, chromosome 11 at 5,874,163 bp (GRCm38)
  • T to A, chromosome 11 at 53,436,684 bp (GRCm38)
  • T to A, chromosome 11 at 58,922,363 bp (GRCm38)
  • T to C, chromosome 11 at 67,286,389 bp (GRCm38)
  • T to A, chromosome 11 at 88,981,800 bp (GRCm38)
  • T to A, chromosome 11 at 94,573,065 bp (GRCm38)
  • T to A, chromosome 11 at 98,467,206 bp (GRCm38)
  • T to C, chromosome 11 at 100,893,788 bp (GRCm38)
  • T to A, chromosome 11 at 103,208,953 bp (GRCm38)
  • T to C, chromosome 11 at 103,612,996 bp (GRCm38)
  • T to A, chromosome 11 at 106,151,034 bp (GRCm38)
  • T to A, chromosome 11 at 110,074,184 bp (GRCm38)
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp (GRCm38)
  • A to G, chromosome 12 at 3,959,971 bp (GRCm38)
  • A to T, chromosome 12 at 55,057,305 bp (GRCm38)
  • C to T, chromosome 12 at 81,559,059 bp (GRCm38)
  • C to T, chromosome 12 at 85,044,402 bp (GRCm38)
  • A to T, chromosome 12 at 104,118,627 bp (GRCm38)
  • G to A, chromosome 12 at 105,604,819 bp (GRCm38)
  • G to T, chromosome 12 at 109,590,279 bp (GRCm38)
  • A to G, chromosome 13 at 22,772,619 bp (GRCm38)
  • C to A, chromosome 13 at 23,478,678 bp (GRCm38)
  • T to C, chromosome 13 at 50,425,569 bp (GRCm38)
  • A to T, chromosome 13 at 60,896,042 bp (GRCm38)
  • T to A, chromosome 13 at 62,172,847 bp (GRCm38)
  • A to G, chromosome 14 at 33,955,520 bp (GRCm38)
  • T to A, chromosome 14 at 61,211,597 bp (GRCm38)
  • G to T, chromosome 14 at 99,137,174 bp (GRCm38)
  • G to A, chromosome 15 at 28,290,276 bp (GRCm38)
  • G to T, chromosome 15 at 80,560,034 bp (GRCm38)
  • A to T, chromosome 15 at 89,419,269 bp (GRCm38)
  • T to A, chromosome 15 at 102,534,277 bp (GRCm38)
  • A to G, chromosome 16 at 4,765,006 bp (GRCm38)
  • G to T, chromosome 16 at 26,516,749 bp (GRCm38)
  • T to A, chromosome 16 at 55,241,338 bp (GRCm38)
  • T to C, chromosome 16 at 94,134,721 bp (GRCm38)
  • T to A, chromosome 16 at 94,448,059 bp (GRCm38)
  • T to G, chromosome 17 at 21,723,291 bp (GRCm38)
  • A to G, chromosome 17 at 25,115,225 bp (GRCm38)
  • C to A, chromosome 17 at 25,168,407 bp (GRCm38)
  • C to T, chromosome 17 at 25,309,937 bp (GRCm38)
  • T to G, chromosome 17 at 28,807,178 bp (GRCm38)
  • T to A, chromosome 17 at 30,713,047 bp (GRCm38)
  • G to T, chromosome 17 at 32,356,965 bp (GRCm38)
  • C to T, chromosome 17 at 34,844,782 bp (GRCm38)
  • A to G, chromosome 17 at 55,662,465 bp (GRCm38)
  • T to G, chromosome 17 at 70,657,463 bp (GRCm38)
  • T to G, chromosome 17 at 73,830,366 bp (GRCm38)
  • A to G, chromosome 18 at 7,002,457 bp (GRCm38)
  • T to C, chromosome 18 at 37,513,919 bp (GRCm38)
  • T to G, chromosome 18 at 46,884,439 bp (GRCm38)
  • C to T, chromosome 18 at 65,305,943 bp (GRCm38)
  • C to T, chromosome 18 at 76,858,681 bp (GRCm38)
  • A to G, chromosome 19 at 6,509,857 bp (GRCm38)
  • A to G, chromosome 19 at 18,873,876 bp (GRCm38)
  • T to A, chromosome 19 at 41,603,422 bp (GRCm38)
  • A to G, chromosome 19 at 43,717,450 bp (GRCm38)
  • A to T, chromosome 19 at 56,473,196 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9564 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069358-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.