Strain Name:
C57BL/6J-MtgxR9565Btlr/Mmmh
Stock Number:
069359-MU
Citation ID:
RRID:MMRRC_069359-MU
Other Names:
R9565 (G1)
Major Collection:

Strain Information

Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Pias3
Name: protein inhibitor of activated STAT 3
Synonyms: Pias3L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229615
Homologene: 4447
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Kcr2-1, Shaw, C230009H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Snx17
Name: sorting nexin 17
Synonyms: 5830447M19Rik, D5Ertd260e, b2b1625.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 266781
Homologene: 8838
Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Serpinb6a
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonyms: Spi3, ovalbumin, D330015H01Rik, 4930482L21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20719
HGNC: HGNC:8950
Homologene: 20956
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Pabpc4
Name: poly(A) binding protein, cytoplasmic 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230721
HGNC: HGNC:8557
Homologene: 37855
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Mark3
Name: MAP/microtubule affinity regulating kinase 3
Synonyms: ETK-1, 1600015G02Rik, A430080F22Rik, C-TAK1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17169
VEGA: 12
HGNC: HGNC:6897
Homologene: 55653
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Cap1
Name: cyclase associated actin cytoskeleton regulatory protein 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12331
Homologene: 74572
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Hipk2
Name: homeodomain interacting protein kinase 2
Synonyms: Stank, 1110014O20Rik, B230339E18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15258
Homologene: 68766
Tlr4
Name: toll-like receptor 4
Synonyms: Lps, Rasl2-8, lipopolysaccharide response
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Bdkrb1
Name: bradykinin receptor, beta 1
Synonyms: kinin B1, B1R
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12061
HGNC: HGNC:1029
Homologene: 570
Arl4c
Name: ADP-ribosylation factor-like 4C
Synonyms: A630084M22Rik, Arl7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320982
HGNC: HGNC:698
Homologene: 4193
Etv6
Name: ets variant 6
Synonyms: Tel, translocation-ets-leukemia
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14011
HGNC: HGNC:3495
Homologene: 37560
Ik
Name: IK cytokine
Synonyms: MuRED
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 24010
VEGA: 18
HGNC: HGNC:5958
Homologene: 36193
Ctdsp2
Name: CTD small phosphatase 2
Synonyms: SCP2, OS4, D10Ertd73e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52468
VEGA: 10
Homologene: 128791
Sema6a
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms: VIa, sema, Sema6A-1, Semaq, A730020P05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20358
Homologene: 32426
Tubb4a
Name: tubulin, beta 4A class IVA
Synonyms: Tubb, Tubb4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22153
VEGA: 17
Homologene: 55952
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Ccdc187
Name: coiled-coil domain containing 187
Synonyms: 4932418E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329366
Homologene: 77630
Acvr1
Name: activin A receptor, type 1
Synonyms: ActR-I, ALK2, Acvr, Acvrlk2, ActRIA, SKR1, Tsk7L, D330013D15Rik, Alk8, Alk-2, Acvr1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11477
HGNC: HGNC:171
Homologene: 7
Cdk12
Name: cyclin dependent kinase 12
Synonyms: 1810022J16Rik, Crk7, D11Ertd752e, Crkrs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69131
Homologene: 128632
Timm50
Name: translocase of inner mitochondrial membrane 50
Synonyms: TIM50L, 2810403L02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66525
Homologene: 57031
Rpl24
Name: ribosomal protein L24
Synonyms: 0610008L05Rik, Bst
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68193
Homologene: 763
Wdr36
Name: WD repeat domain 36
Synonyms: 5730444A13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225348
VEGA: 18
Homologene: 6536
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104806
VEGA: 12
Homologene: 35378
Skor2
Name: SKI family transcriptional corepressor 2
Synonyms: Fussel18, Corl2, Gm7348
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 664805
VEGA: 18
Homologene: 64797
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Skic2
Name: SKI2 subunit of superkiller complex
Synonyms: Ski2w, 4930534J06Rik, Skiv2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 108077
Homologene: 123971
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, 1700047E16Rik, fantom, Nphp8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Ppp1r3a
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140491
HGNC: HGNC:9291
Homologene: 48124
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
C7
Name: complement component 7
Synonyms: LOC383055
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109828
VEGA: 15
HGNC: HGNC:1346
Homologene: 489
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: LOC330830, SRG-L, Ccdc135
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330830
Homologene: 12996
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Trim44
Name: tripartite motif-containing 44
Synonyms: DIPB, Mc7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80985
Homologene: 9731
Tuba8
Name: tubulin, alpha 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53857
Homologene: 56766
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Epas1
Name: endothelial PAS domain protein 1
Synonyms: MOP2, HIF-2alpha, Hif like protein, hypoxia inducible transcription factor 2alpha, HLF, HRF, HIF2A, bHLHe73
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13819
VEGA: 17
HGNC: HGNC:3374
Homologene: 1095
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Duox1
Name: dual oxidase 1
Synonyms: NOXEF1, THOX1, LNOX1, 9930101G15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Slc8b1
Name: solute carrier family 8 (sodium/lithium/calcium exchanger), member B1
Synonyms: NCKX6, NCLX, Slc24a6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170756
Homologene: 41602
Btn2a2
Name: butyrophilin, subfamily 2, member A2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238555
Homologene: 56012
Hltf
Name: helicase-like transcription factor
Synonyms: P113, Snf2l3, Smarca3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20585
Homologene: 30136
Myom2
Name: myomesin 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Vmn1r208
Name: vomeronasal 1 receptor 208
Synonyms: V1rh9, Vmn1r208-ps
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171252
Homologene: 110880
Myocd
Name: myocardin
Synonyms: Srfcp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214384
Homologene: 17043
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Top2b
Name: topoisomerase (DNA) II beta
Synonyms: Top-2, D230016L12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21974
Homologene: 134711
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Aoc1l2
Name: amine oxidase copper containing 1-like 2
Synonyms: 1600015I10Rik, Doxl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69761
HGNC: HGNC:80
Homologene: 79726
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Pde6c
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110855
VEGA: 19
HGNC: HGNC:8787
Homologene: 4521
Ccdc30
Name: coiled-coil domain containing 30
Synonyms: 1700111D19Rik, 4930445I03Rik, 1700001O02Rik, 1700041C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73332
Homologene: 137391
Ankdd1a
Name: ankyrin repeat and death domain containing 1A
Synonyms: LOC384945, EG330963
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330963
VEGA: 9
Homologene: 65619
Lrrc15
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74488
Homologene: 26080
Or2w25
Name: olfactory receptor family 2 subfamily W member 25
Synonyms: GA_x6K02T0073K-490-1545, MOR256-51, Olfr225
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257886
Homologene: 105324
Amn1
Name: antagonist of mitotic exit network 1
Synonyms: C730024G19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232566
Homologene: 45811
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67722
Homologene: 69412
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Kif21b
Name: kinesin family member 21B
Synonyms: N-5 kinesin, 2610511N21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16565
Homologene: 56868
Mrgprb2
Name: MAS-related GPR, member B2
Synonyms: 4833406I20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243979
Homologene: 86246
Wiz
Name: widely-interspaced zinc finger motifs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22404
Homologene: 7997
Slc26a7
Name: solute carrier family 26, member 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 208890
Homologene: 13770
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Slc2a4
Name: solute carrier family 2 (facilitated glucose transporter), member 4
Synonyms: Glut-4, Glut4, twgy
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20528
Homologene: 74381
Krt8
Name: keratin 8
Synonyms: K8, EndoA, cytokeratin-8, cytokeratin8, cytokeratin 8, Krt-2.8, Card2, Krt2-8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16691
VEGA: 15
HGNC: HGNC:6446
Homologene: 55643
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Lvrn
Name: laeverin
Synonyms: 4833403I15Rik, Aqpep
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74574
VEGA: 18
Homologene: 51352
Ces1g
Name: carboxylesterase 1G
Synonyms: Ces-1, Ses-1, Ces1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12623
HGNC: HGNC:1863
Homologene: 137354
Fbxw17
Name: F-box and WD-40 domain protein 17
Synonyms: 1110064L07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109082
Homologene: 82571
Fbln5
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23876
VEGA: 12
HGNC: HGNC:3602
Homologene: 38170
Or6c33
Name: olfactory receptor family 6 subfamily C member 33
Synonyms: GA_x6K02T2PULF-11688441-11689379, MOR116-1, Olfr820
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258670
Homologene: 17337
Tle2
Name: transducin-like enhancer of split 2
Synonyms: Grg2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21886
Homologene: 20693
Dsc1
Name: desmocollin 1
Synonyms: Dsc1b, Dsc1a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13505
VEGA: 18
HGNC: HGNC:3035
Homologene: 22761
Btnl10
Name: butyrophilin-like 10
Synonyms: BUTR-1, Butr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192194
Homologene: 138184
Map3k3
Name: mitogen-activated protein kinase kinase kinase 3
Synonyms: MAPKKK3, Mekk3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26406
HGNC: HGNC:6855
Homologene: 69110
Vmn1r189
Name: vomeronasal 1 receptor 189
Synonyms: V1rh2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252906
Homologene: 110880
Dlgap1
Name: DLG associated protein 1
Synonyms: SAPAP1, DAP-1 beta, D17Bwg0511e, GKAP/SAPAP, Sapap1, 4933422O14Rik, Gkap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Pknox2
Name: Pbx/knotted 1 homeobox 2
Synonyms: Prep2, D230005H23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208076
Homologene: 32527
Tmem214
Name: transmembrane protein 214
Synonyms: 4921530J21Rik, 1110039B18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68796
Homologene: 9801
Slfn5
Name: schlafen 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327978
Homologene: 18839
Asgr2
Name: asialoglycoprotein receptor 2
Synonyms: Asgr-2, Asgr, ASGPR2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11890
HGNC: HGNC:743
Homologene: 912
Epdr1
Name: ependymin related 1
Synonyms: MERP-1, MERP2, Ucc1, MERP-2, Epdr1, Epdr2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105298
VEGA: 13
Homologene: 9714
Actr5
Name: ARP5 actin-related protein 5
Synonyms: B430109J19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109275
Homologene: 6818
Cyp4f37
Name: cytochrome P450, family 4, subfamily f, polypeptide 37
Synonyms: Gm9705
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 677156
VEGA: 17
Homologene: 135840
Telo2
Name: telomere maintenance 2
Synonyms: 1200003M09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71718
Homologene: 41107
Gdf9
Name: growth differentiation factor 9
Synonyms: Gdf-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14566
HGNC: HGNC:4224
Homologene: 3851
Or1l4
Name: olfactory receptor family 1 subfamily L member 4
Synonyms: GA_x6K02T2NLDC-33885305-33886243, MOR138-1, Olfr365
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258656
Homologene: 74156
Gm8369
Name: predicted gene 8369
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 666926
Krtap6-2
Name: keratin associated protein 6-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16701
Gm14295
Name: predicted gene 14295
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100039123
Homologene: 133105
Ugdh
Name: UDP-glucose dehydrogenase
Synonyms: Udpgdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22235
Homologene: 2520
Sec61b
Name: SEC61 translocon subunit beta
Synonyms: 1190006C12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66212
Homologene: 38229
Tbcb
Name: tubulin folding cofactor B
Synonyms: 2410007D12Rik, Ckap1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66411
HGNC: HGNC:1989
Homologene: 981
Gcnt7
Name: glucosaminyl (N-acetyl) transferase family member 7
Synonyms: A330041C17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 654821
Homologene: 107308
Inka1
Name: inka box actin regulator 1
Synonyms: Inka1, 6230427J02Rik, Fam212a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68176
Homologene: 19818
Rp2
Name: retinitis pigmentosa 2 homolog
Synonyms: Rp2h
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 19889
Homologene: 5042
Klrc1
Name: killer cell lectin-like receptor subfamily C, member 1
Synonyms: NKG2B, NKG2A, CD159a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16641
Homologene: 86848
Cdc42ep1
Name: CDC42 effector protein 1
Synonyms: MSE55, CEP1, 1810058K22Rik, Borg5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 104445
VEGA: 15
Homologene: 5128
Vmn2r29
Name: vomeronasal 2, receptor 29
Synonyms: 6430701C03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76229
Homologene: 113703
Fbxw25
Name: F-box and WD-40 domain protein 25
Synonyms: E330001B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546160
Msantd5f4
Name: Myb/SANT DNA binding domain containing 5 family member 4
Synonyms: Gm11236
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100862015
Homologene: 128423
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp (GRCm38)
  • A to G, chromosome 1 at 88,701,412 bp (GRCm38)
  • T to C, chromosome 1 at 105,664,151 bp (GRCm38)
  • A to T, chromosome 1 at 136,149,352 bp (GRCm38)
  • T to C, chromosome 2 at 26,293,686 bp (GRCm38)
  • G to T, chromosome 2 at 37,201,563 bp (GRCm38)
  • T to C, chromosome 2 at 58,448,373 bp (GRCm38)
  • A to T, chromosome 2 at 101,642,982 bp (GRCm38)
  • T to C, chromosome 2 at 102,357,482 bp (GRCm38)
  • T to C, chromosome 2 at 122,320,722 bp (GRCm38)
  • G to A, chromosome 2 at 130,806,791 bp (GRCm38)
  • A to G, chromosome 2 at 158,628,215 bp (GRCm38)
  • T to A, chromosome 2 at 172,451,260 bp (GRCm38)
  • T to C, chromosome 2 at 176,807,369 bp (GRCm38)
  • G to A, chromosome 3 at 20,082,832 bp (GRCm38)
  • T to A, chromosome 3 at 96,703,551 bp (GRCm38)
  • T to C, chromosome 4 at 14,519,496 bp (GRCm38)
  • A to G, chromosome 4 at 47,483,049 bp (GRCm38)
  • G to T, chromosome 4 at 56,772,521 bp (GRCm38)
  • G to A, chromosome 4 at 66,841,285 bp (GRCm38)
  • G to T, chromosome 4 at 73,638,953 bp (GRCm38)
  • A to G, chromosome 4 at 96,526,008 bp (GRCm38)
  • T to A, chromosome 4 at 117,564,816 bp (GRCm38)
  • T to C, chromosome 4 at 119,393,624 bp (GRCm38)
  • A to G, chromosome 4 at 122,864,712 bp (GRCm38)
  • T to C, chromosome 4 at 123,286,860 bp (GRCm38)
  • G to A, chromosome 5 at 30,869,699 bp (GRCm38)
  • C to A, chromosome 5 at 31,197,744 bp (GRCm38)
  • C to A, chromosome 5 at 65,418,533 bp (GRCm38)
  • A to G, chromosome 5 at 108,191,934 bp (GRCm38)
  • A to G, chromosome 5 at 120,527,800 bp (GRCm38)
  • T to A, chromosome 6 at 14,719,467 bp (GRCm38)
  • T to A, chromosome 6 at 38,747,455 bp (GRCm38)
  • A to T, chromosome 6 at 48,044,646 bp (GRCm38)
  • T to C, chromosome 6 at 48,930,975 bp (GRCm38)
  • A to G, chromosome 6 at 58,859,014 bp (GRCm38)
  • A to G, chromosome 6 at 121,223,104 bp (GRCm38)
  • A to G, chromosome 6 at 129,678,783 bp (GRCm38)
  • A to G, chromosome 6 at 134,248,709 bp (GRCm38)
  • C to T, chromosome 6 at 149,188,605 bp (GRCm38)
  • A to T, chromosome 7 at 7,241,856 bp (GRCm38)
  • A to C, chromosome 7 at 10,159,549 bp (GRCm38)
  • A to G, chromosome 7 at 28,307,644 bp (GRCm38)
  • A to T, chromosome 7 at 30,231,124 bp (GRCm38)
  • G to A, chromosome 7 at 46,427,586 bp (GRCm38)
  • G to A, chromosome 7 at 48,552,926 bp (GRCm38)
  • A to G, chromosome 7 at 64,349,492 bp (GRCm38)
  • A to G, chromosome 7 at 120,010,891 bp (GRCm38)
  • GTT to GTTT, chromosome 7 at 135,707,504 bp (GRCm38)
  • A to T, chromosome 8 at 15,108,399 bp (GRCm38)
  • T to C, chromosome 8 at 40,824,718 bp (GRCm38)
  • TGG to TG, chromosome 8 at 88,326,425 bp (GRCm38)
  • A to C, chromosome 8 at 91,304,888 bp (GRCm38)
  • A to G, chromosome 8 at 93,335,164 bp (GRCm38)
  • A to G, chromosome 8 at 95,075,238 bp (GRCm38)
  • A to C, chromosome 8 at 112,856,350 bp (GRCm38)
  • TG to TGG, chromosome 9 at 7,465,083 bp (GRCm38)
  • A to T, chromosome 9 at 36,923,771 bp (GRCm38)
  • C to T, chromosome 9 at 65,504,170 bp (GRCm38)
  • A to T, chromosome 9 at 107,930,922 bp (GRCm38)
  • T to A, chromosome 9 at 107,984,289 bp (GRCm38)
  • T to C, chromosome 9 at 108,962,741 bp (GRCm38)
  • T to A, chromosome 9 at 109,654,608 bp (GRCm38)
  • T to C, chromosome 10 at 52,067,074 bp (GRCm38)
  • A to G, chromosome 10 at 81,581,733 bp (GRCm38)
  • A to G, chromosome 10 at 126,996,171 bp (GRCm38)
  • T to C, chromosome 10 at 130,017,418 bp (GRCm38)
  • T to A, chromosome 11 at 53,436,684 bp (GRCm38)
  • T to A, chromosome 11 at 58,922,363 bp (GRCm38)
  • T to G, chromosome 11 at 59,613,513 bp (GRCm38)
  • T to C, chromosome 11 at 65,187,383 bp (GRCm38)
  • C to T, chromosome 11 at 67,092,361 bp (GRCm38)
  • T to C, chromosome 11 at 67,286,389 bp (GRCm38)
  • A to G, chromosome 11 at 69,946,347 bp (GRCm38)
  • T to A, chromosome 11 at 70,105,484 bp (GRCm38)
  • A to T, chromosome 11 at 82,956,873 bp (GRCm38)
  • A to G, chromosome 11 at 98,249,802 bp (GRCm38)
  • T to A, chromosome 11 at 106,151,034 bp (GRCm38)
  • A to G, chromosome 12 at 65,121,720 bp (GRCm38)
  • A to T, chromosome 12 at 101,768,463 bp (GRCm38)
  • G to A, chromosome 12 at 105,604,819 bp (GRCm38)
  • A to G, chromosome 12 at 111,604,526 bp (GRCm38)
  • A to G, chromosome 13 at 19,594,651 bp (GRCm38)
  • A to G, chromosome 13 at 22,102,256 bp (GRCm38)
  • A to G, chromosome 13 at 22,772,619 bp (GRCm38)
  • C to A, chromosome 13 at 23,478,678 bp (GRCm38)
  • T to A, chromosome 13 at 33,918,417 bp (GRCm38)
  • T to C, chromosome 13 at 50,425,569 bp (GRCm38)
  • A to C, chromosome 14 at 16,365,718 bp (GRCm38)
  • C to A, chromosome 14 at 26,875,324 bp (GRCm38)
  • T to C, chromosome 14 at 27,479,809 bp (GRCm38)
  • C to A, chromosome 14 at 31,264,437 bp (GRCm38)
  • T to A, chromosome 15 at 5,057,097 bp (GRCm38)
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp (GRCm38)
  • A to T, chromosome 15 at 78,849,582 bp (GRCm38)
  • G to A, chromosome 15 at 81,889,434 bp (GRCm38)
  • A to T, chromosome 15 at 99,278,804 bp (GRCm38)
  • G to A, chromosome 15 at 99,279,735 bp (GRCm38)
  • A to G, chromosome 15 at 102,004,025 bp (GRCm38)
  • T to A, chromosome 15 at 102,319,798 bp (GRCm38)
  • G to A, chromosome 16 at 30,274,198 bp (GRCm38)
  • A to G, chromosome 16 at 35,857,405 bp (GRCm38)
  • T to A, chromosome 16 at 55,970,146 bp (GRCm38)
  • A to T, chromosome 16 at 70,401,776 bp (GRCm38)
  • A to G, chromosome 16 at 89,419,834 bp (GRCm38)
  • A to G, chromosome 17 at 25,115,225 bp (GRCm38)
  • G to T, chromosome 17 at 32,356,965 bp (GRCm38)
  • A to G, chromosome 17 at 32,625,231 bp (GRCm38)
  • C to T, chromosome 17 at 34,844,782 bp (GRCm38)
  • A to G, chromosome 17 at 55,662,465 bp (GRCm38)
  • A to G, chromosome 17 at 57,081,027 bp (GRCm38)
  • T to G, chromosome 17 at 70,657,463 bp (GRCm38)
  • T to A, chromosome 17 at 86,805,239 bp (GRCm38)
  • T to A, chromosome 18 at 20,107,734 bp (GRCm38)
  • C to T, chromosome 18 at 32,861,115 bp (GRCm38)
  • C to A, chromosome 18 at 36,753,906 bp (GRCm38)
  • T to G, chromosome 18 at 46,884,439 bp (GRCm38)
  • A to T, chromosome 18 at 47,249,527 bp (GRCm38)
  • T to C, chromosome 18 at 58,095,226 bp (GRCm38)
  • C to T, chromosome 18 at 76,858,681 bp (GRCm38)
  • T to G, chromosome 19 at 6,320,666 bp (GRCm38)
  • A to C, chromosome 19 at 11,511,651 bp (GRCm38)
  • T to A, chromosome 19 at 38,158,560 bp (GRCm38)
  • A to G, chromosome X at 20,377,542 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9565 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069359-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.