Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9565Btlr/Mmmh
Stock Number:
069359-MU
Citation ID:
RRID:MMRRC_069359-MU
Other Names:
R9565 (G1)
Major Collection:

Strain Information

Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Pias3
Name: protein inhibitor of activated STAT 3
Synonyms: Pias3L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229615
Homologene: 4447
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Kcr2-1, Shaw, C230009H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Snx17
Name: sorting nexin 17
Synonyms: 5830447M19Rik, D5Ertd260e, b2b1625.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 266781
Homologene: 8838
Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Serpinb6a
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonyms: Spi3, ovalbumin, D330015H01Rik, 4930482L21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20719
HGNC: HGNC:8950
Homologene: 20956
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp (GRCm38)
  • A to G, chromosome 1 at 88,701,412 bp (GRCm38)
  • T to C, chromosome 1 at 105,664,151 bp (GRCm38)
  • A to T, chromosome 1 at 136,149,352 bp (GRCm38)
  • T to C, chromosome 2 at 26,293,686 bp (GRCm38)
  • G to T, chromosome 2 at 37,201,563 bp (GRCm38)
  • T to C, chromosome 2 at 58,448,373 bp (GRCm38)
  • A to T, chromosome 2 at 101,642,982 bp (GRCm38)
  • T to C, chromosome 2 at 102,357,482 bp (GRCm38)
  • T to C, chromosome 2 at 122,320,722 bp (GRCm38)
  • G to A, chromosome 2 at 130,806,791 bp (GRCm38)
  • A to G, chromosome 2 at 158,628,215 bp (GRCm38)
  • T to A, chromosome 2 at 172,451,260 bp (GRCm38)
  • T to C, chromosome 2 at 176,807,369 bp (GRCm38)
  • G to A, chromosome 3 at 20,082,832 bp (GRCm38)
  • T to A, chromosome 3 at 96,703,551 bp (GRCm38)
  • T to C, chromosome 4 at 14,519,496 bp (GRCm38)
  • A to G, chromosome 4 at 47,483,049 bp (GRCm38)
  • G to T, chromosome 4 at 56,772,521 bp (GRCm38)
  • G to A, chromosome 4 at 66,841,285 bp (GRCm38)
  • G to T, chromosome 4 at 73,638,953 bp (GRCm38)
  • A to G, chromosome 4 at 96,526,008 bp (GRCm38)
  • T to A, chromosome 4 at 117,564,816 bp (GRCm38)
  • T to C, chromosome 4 at 119,393,624 bp (GRCm38)
  • A to G, chromosome 4 at 122,864,712 bp (GRCm38)
  • T to C, chromosome 4 at 123,286,860 bp (GRCm38)
  • G to A, chromosome 5 at 30,869,699 bp (GRCm38)
  • C to A, chromosome 5 at 31,197,744 bp (GRCm38)
  • C to A, chromosome 5 at 65,418,533 bp (GRCm38)
  • A to G, chromosome 5 at 108,191,934 bp (GRCm38)
  • A to G, chromosome 5 at 120,527,800 bp (GRCm38)
  • T to A, chromosome 6 at 14,719,467 bp (GRCm38)
  • T to A, chromosome 6 at 38,747,455 bp (GRCm38)
  • A to T, chromosome 6 at 48,044,646 bp (GRCm38)
  • T to C, chromosome 6 at 48,930,975 bp (GRCm38)
  • A to G, chromosome 6 at 58,859,014 bp (GRCm38)
  • A to G, chromosome 6 at 121,223,104 bp (GRCm38)
  • A to G, chromosome 6 at 129,678,783 bp (GRCm38)
  • A to G, chromosome 6 at 134,248,709 bp (GRCm38)
  • C to T, chromosome 6 at 149,188,605 bp (GRCm38)
  • A to T, chromosome 7 at 7,241,856 bp (GRCm38)
  • A to C, chromosome 7 at 10,159,549 bp (GRCm38)
  • A to G, chromosome 7 at 28,307,644 bp (GRCm38)
  • A to T, chromosome 7 at 30,231,124 bp (GRCm38)
  • G to A, chromosome 7 at 46,427,586 bp (GRCm38)
  • G to A, chromosome 7 at 48,552,926 bp (GRCm38)
  • A to G, chromosome 7 at 64,349,492 bp (GRCm38)
  • A to G, chromosome 7 at 120,010,891 bp (GRCm38)
  • GTT to GTTT, chromosome 7 at 135,707,504 bp (GRCm38)
  • A to T, chromosome 8 at 15,108,399 bp (GRCm38)
  • T to C, chromosome 8 at 40,824,718 bp (GRCm38)
  • TGG to TG, chromosome 8 at 88,326,425 bp (GRCm38)
  • A to C, chromosome 8 at 91,304,888 bp (GRCm38)
  • A to G, chromosome 8 at 93,335,164 bp (GRCm38)
  • A to G, chromosome 8 at 95,075,238 bp (GRCm38)
  • A to C, chromosome 8 at 112,856,350 bp (GRCm38)
  • TG to TGG, chromosome 9 at 7,465,083 bp (GRCm38)
  • A to T, chromosome 9 at 36,923,771 bp (GRCm38)
  • C to T, chromosome 9 at 65,504,170 bp (GRCm38)
  • A to T, chromosome 9 at 107,930,922 bp (GRCm38)
  • T to A, chromosome 9 at 107,984,289 bp (GRCm38)
  • T to C, chromosome 9 at 108,962,741 bp (GRCm38)
  • T to A, chromosome 9 at 109,654,608 bp (GRCm38)
  • T to C, chromosome 10 at 52,067,074 bp (GRCm38)
  • A to G, chromosome 10 at 81,581,733 bp (GRCm38)
  • A to G, chromosome 10 at 126,996,171 bp (GRCm38)
  • T to C, chromosome 10 at 130,017,418 bp (GRCm38)
  • T to A, chromosome 11 at 53,436,684 bp (GRCm38)
  • T to A, chromosome 11 at 58,922,363 bp (GRCm38)
  • T to G, chromosome 11 at 59,613,513 bp (GRCm38)
  • T to C, chromosome 11 at 65,187,383 bp (GRCm38)
  • C to T, chromosome 11 at 67,092,361 bp (GRCm38)
  • T to C, chromosome 11 at 67,286,389 bp (GRCm38)
  • A to G, chromosome 11 at 69,946,347 bp (GRCm38)
  • T to A, chromosome 11 at 70,105,484 bp (GRCm38)
  • A to T, chromosome 11 at 82,956,873 bp (GRCm38)
  • A to G, chromosome 11 at 98,249,802 bp (GRCm38)
  • T to A, chromosome 11 at 106,151,034 bp (GRCm38)
  • A to G, chromosome 12 at 65,121,720 bp (GRCm38)
  • A to T, chromosome 12 at 101,768,463 bp (GRCm38)
  • G to A, chromosome 12 at 105,604,819 bp (GRCm38)
  • A to G, chromosome 12 at 111,604,526 bp (GRCm38)
  • A to G, chromosome 13 at 19,594,651 bp (GRCm38)
  • A to G, chromosome 13 at 22,102,256 bp (GRCm38)
  • A to G, chromosome 13 at 22,772,619 bp (GRCm38)
  • C to A, chromosome 13 at 23,478,678 bp (GRCm38)
  • T to A, chromosome 13 at 33,918,417 bp (GRCm38)
  • T to C, chromosome 13 at 50,425,569 bp (GRCm38)
  • A to C, chromosome 14 at 16,365,718 bp (GRCm38)
  • C to A, chromosome 14 at 26,875,324 bp (GRCm38)
  • T to C, chromosome 14 at 27,479,809 bp (GRCm38)
  • C to A, chromosome 14 at 31,264,437 bp (GRCm38)
  • T to A, chromosome 15 at 5,057,097 bp (GRCm38)
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp (GRCm38)
  • A to T, chromosome 15 at 78,849,582 bp (GRCm38)
  • G to A, chromosome 15 at 81,889,434 bp (GRCm38)
  • A to T, chromosome 15 at 99,278,804 bp (GRCm38)
  • G to A, chromosome 15 at 99,279,735 bp (GRCm38)
  • A to G, chromosome 15 at 102,004,025 bp (GRCm38)
  • T to A, chromosome 15 at 102,319,798 bp (GRCm38)
  • G to A, chromosome 16 at 30,274,198 bp (GRCm38)
  • A to G, chromosome 16 at 35,857,405 bp (GRCm38)
  • T to A, chromosome 16 at 55,970,146 bp (GRCm38)
  • A to T, chromosome 16 at 70,401,776 bp (GRCm38)
  • A to G, chromosome 16 at 89,419,834 bp (GRCm38)
  • A to G, chromosome 17 at 25,115,225 bp (GRCm38)
  • G to T, chromosome 17 at 32,356,965 bp (GRCm38)
  • A to G, chromosome 17 at 32,625,231 bp (GRCm38)
  • C to T, chromosome 17 at 34,844,782 bp (GRCm38)
  • A to G, chromosome 17 at 55,662,465 bp (GRCm38)
  • A to G, chromosome 17 at 57,081,027 bp (GRCm38)
  • T to G, chromosome 17 at 70,657,463 bp (GRCm38)
  • T to A, chromosome 17 at 86,805,239 bp (GRCm38)
  • T to A, chromosome 18 at 20,107,734 bp (GRCm38)
  • C to T, chromosome 18 at 32,861,115 bp (GRCm38)
  • C to A, chromosome 18 at 36,753,906 bp (GRCm38)
  • T to G, chromosome 18 at 46,884,439 bp (GRCm38)
  • A to T, chromosome 18 at 47,249,527 bp (GRCm38)
  • T to C, chromosome 18 at 58,095,226 bp (GRCm38)
  • C to T, chromosome 18 at 76,858,681 bp (GRCm38)
  • T to G, chromosome 19 at 6,320,666 bp (GRCm38)
  • A to C, chromosome 19 at 11,511,651 bp (GRCm38)
  • T to A, chromosome 19 at 38,158,560 bp (GRCm38)
  • A to G, chromosome X at 20,377,542 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9565 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069359-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.