MMRRC:069359-MU

TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp (GRCm38)
A to G, chromosome 1 at 88,701,412 bp (GRCm38)
T to C, chromosome 1 at 105,664,151 bp (GRCm38)
A to T, chromosome 1 at 136,149,352 bp (GRCm38)
T to C, chromosome 2 at 26,293,686 bp (GRCm38)
G to T, chromosome 2 at 37,201,563 bp (GRCm38)
T to C, chromosome 2 at 58,448,373 bp (GRCm38)
A to T, chromosome 2 at 101,642,982 bp (GRCm38)
T to C, chromosome 2 at 102,357,482 bp (GRCm38)
T to C, chromosome 2 at 122,320,722 bp (GRCm38)
G to A, chromosome 2 at 130,806,791 bp (GRCm38)
A to G, chromosome 2 at 158,628,215 bp (GRCm38)
T to A, chromosome 2 at 172,451,260 bp (GRCm38)
T to C, chromosome 2 at 176,807,369 bp (GRCm38)
G to A, chromosome 3 at 20,082,832 bp (GRCm38)
T to A, chromosome 3 at 96,703,551 bp (GRCm38)
T to C, chromosome 4 at 14,519,496 bp (GRCm38)
A to G, chromosome 4 at 47,483,049 bp (GRCm38)
G to T, chromosome 4 at 56,772,521 bp (GRCm38)
G to A, chromosome 4 at 66,841,285 bp (GRCm38)
G to T, chromosome 4 at 73,638,953 bp (GRCm38)
A to G, chromosome 4 at 96,526,008 bp (GRCm38)
T to A, chromosome 4 at 117,564,816 bp (GRCm38)
T to C, chromosome 4 at 119,393,624 bp (GRCm38)
A to G, chromosome 4 at 122,864,712 bp (GRCm38)
T to C, chromosome 4 at 123,286,860 bp (GRCm38)
G to A, chromosome 5 at 30,869,699 bp (GRCm38)
C to A, chromosome 5 at 31,197,744 bp (GRCm38)
C to A, chromosome 5 at 65,418,533 bp (GRCm38)
A to G, chromosome 5 at 108,191,934 bp (GRCm38)
A to G, chromosome 5 at 120,527,800 bp (GRCm38)
T to A, chromosome 6 at 14,719,467 bp (GRCm38)
T to A, chromosome 6 at 38,747,455 bp (GRCm38)
A to T, chromosome 6 at 48,044,646 bp (GRCm38)
T to C, chromosome 6 at 48,930,975 bp (GRCm38)
A to G, chromosome 6 at 58,859,014 bp (GRCm38)
A to G, chromosome 6 at 121,223,104 bp (GRCm38)
A to G, chromosome 6 at 129,678,783 bp (GRCm38)
A to G, chromosome 6 at 134,248,709 bp (GRCm38)
C to T, chromosome 6 at 149,188,605 bp (GRCm38)
A to T, chromosome 7 at 7,241,856 bp (GRCm38)
A to C, chromosome 7 at 10,159,549 bp (GRCm38)
A to G, chromosome 7 at 28,307,644 bp (GRCm38)
A to T, chromosome 7 at 30,231,124 bp (GRCm38)
G to A, chromosome 7 at 46,427,586 bp (GRCm38)
G to A, chromosome 7 at 48,552,926 bp (GRCm38)
A to G, chromosome 7 at 64,349,492 bp (GRCm38)
A to G, chromosome 7 at 120,010,891 bp (GRCm38)
GTT to GTTT, chromosome 7 at 135,707,504 bp (GRCm38)
A to T, chromosome 8 at 15,108,399 bp (GRCm38)
T to C, chromosome 8 at 40,824,718 bp (GRCm38)
TGG to TG, chromosome 8 at 88,326,425 bp (GRCm38)
A to C, chromosome 8 at 91,304,888 bp (GRCm38)
A to G, chromosome 8 at 93,335,164 bp (GRCm38)
A to G, chromosome 8 at 95,075,238 bp (GRCm38)
A to C, chromosome 8 at 112,856,350 bp (GRCm38)
TG to TGG, chromosome 9 at 7,465,083 bp (GRCm38)
A to T, chromosome 9 at 36,923,771 bp (GRCm38)
C to T, chromosome 9 at 65,504,170 bp (GRCm38)
A to T, chromosome 9 at 107,930,922 bp (GRCm38)
T to A, chromosome 9 at 107,984,289 bp (GRCm38)
T to C, chromosome 9 at 108,962,741 bp (GRCm38)
T to A, chromosome 9 at 109,654,608 bp (GRCm38)
T to C, chromosome 10 at 52,067,074 bp (GRCm38)
A to G, chromosome 10 at 81,581,733 bp (GRCm38)
A to G, chromosome 10 at 126,996,171 bp (GRCm38)
T to C, chromosome 10 at 130,017,418 bp (GRCm38)
T to A, chromosome 11 at 53,436,684 bp (GRCm38)
T to A, chromosome 11 at 58,922,363 bp (GRCm38)
T to G, chromosome 11 at 59,613,513 bp (GRCm38)
T to C, chromosome 11 at 65,187,383 bp (GRCm38)
C to T, chromosome 11 at 67,092,361 bp (GRCm38)
T to C, chromosome 11 at 67,286,389 bp (GRCm38)
A to G, chromosome 11 at 69,946,347 bp (GRCm38)
T to A, chromosome 11 at 70,105,484 bp (GRCm38)
A to T, chromosome 11 at 82,956,873 bp (GRCm38)
A to G, chromosome 11 at 98,249,802 bp (GRCm38)
T to A, chromosome 11 at 106,151,034 bp (GRCm38)
A to G, chromosome 12 at 65,121,720 bp (GRCm38)
A to T, chromosome 12 at 101,768,463 bp (GRCm38)
G to A, chromosome 12 at 105,604,819 bp (GRCm38)
A to G, chromosome 12 at 111,604,526 bp (GRCm38)
A to G, chromosome 13 at 19,594,651 bp (GRCm38)
A to G, chromosome 13 at 22,102,256 bp (GRCm38)
A to G, chromosome 13 at 22,772,619 bp (GRCm38)
C to A, chromosome 13 at 23,478,678 bp (GRCm38)
T to A, chromosome 13 at 33,918,417 bp (GRCm38)
T to C, chromosome 13 at 50,425,569 bp (GRCm38)
A to C, chromosome 14 at 16,365,718 bp (GRCm38)
C to A, chromosome 14 at 26,875,324 bp (GRCm38)
T to C, chromosome 14 at 27,479,809 bp (GRCm38)
C to A, chromosome 14 at 31,264,437 bp (GRCm38)
T to A, chromosome 15 at 5,057,097 bp (GRCm38)
TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp (GRCm38)
A to T, chromosome 15 at 78,849,582 bp (GRCm38)
G to A, chromosome 15 at 81,889,434 bp (GRCm38)
A to T, chromosome 15 at 99,278,804 bp (GRCm38)
G to A, chromosome 15 at 99,279,735 bp (GRCm38)
A to G, chromosome 15 at 102,004,025 bp (GRCm38)
T to A, chromosome 15 at 102,319,798 bp (GRCm38)
G to A, chromosome 16 at 30,274,198 bp (GRCm38)
A to G, chromosome 16 at 35,857,405 bp (GRCm38)
T to A, chromosome 16 at 55,970,146 bp (GRCm38)
A to T, chromosome 16 at 70,401,776 bp (GRCm38)
A to G, chromosome 16 at 89,419,834 bp (GRCm38)
A to G, chromosome 17 at 25,115,225 bp (GRCm38)
G to T, chromosome 17 at 32,356,965 bp (GRCm38)
A to G, chromosome 17 at 32,625,231 bp (GRCm38)
C to T, chromosome 17 at 34,844,782 bp (GRCm38)
A to G, chromosome 17 at 55,662,465 bp (GRCm38)
A to G, chromosome 17 at 57,081,027 bp (GRCm38)
T to G, chromosome 17 at 70,657,463 bp (GRCm38)
T to A, chromosome 17 at 86,805,239 bp (GRCm38)
T to A, chromosome 18 at 20,107,734 bp (GRCm38)
C to T, chromosome 18 at 32,861,115 bp (GRCm38)
C to A, chromosome 18 at 36,753,906 bp (GRCm38)
T to G, chromosome 18 at 46,884,439 bp (GRCm38)
A to T, chromosome 18 at 47,249,527 bp (GRCm38)
T to C, chromosome 18 at 58,095,226 bp (GRCm38)
C to T, chromosome 18 at 76,858,681 bp (GRCm38)
T to G, chromosome 19 at 6,320,666 bp (GRCm38)
A to C, chromosome 19 at 11,511,651 bp (GRCm38)
T to A, chromosome 19 at 38,158,560 bp (GRCm38)
A to G, chromosome X at 20,377,542 bp (GRCm38)

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R9565 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
069359-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All