Strain Name:
C57BL/6J-MtgxR9599Btlr/Mmmh
Stock Number:
069392-MU
Citation ID:
RRID:MMRRC_069392-MU
Other Names:
R9599 (G1)
Major Collection:

Strain Information

Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
St3gal5
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Synonyms: ST3Gal V, mST3Gal V, GM3-specific sialytransferase, GM3 synthase, [a]2, 3S-T, Siat9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20454
Homologene: 2893
Mrpl39
Name: mitochondrial ribosomal protein L39
Synonyms: MRP-L5, Rpml5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27393
Homologene: 9679
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Fxr2
Name: FMR1 autosomal homolog 2
Synonyms: Fxr2h
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23879
HGNC: HGNC:4024
Homologene: 21014
Bub3
Name: BUB3 mitotic checkpoint protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12237
HGNC: HGNC:1151
Homologene: 3470
Cse1l
Name: chromosome segregation 1 like
Synonyms: Cas, Capts, 2610100P18Rik, Xpo2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110750
HGNC: HGNC:2431
Homologene: 1006
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Actr2
Name: actin related protein 2
Synonyms: 4921510D23Rik, D6Ertd746e, Arp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66713
HGNC: HGNC:169
Homologene: 4181
Patz1
Name: POZ (BTB) and AT hook containing zinc finger 1
Synonyms: MAZR, 8430401L15Rik, POZ-AT hook-zinc finger protein, Zfp278
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56218
Homologene: 8636
Rnf20
Name: ring finger protein 20
Synonyms: 4833430L21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109331
Homologene: 5571
Dcp1a
Name: decapping mRNA 1A
Synonyms: 1110066A22Rik, SMIF, 4930568L04Rik, D14Ertd817e, Mitc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75901
VEGA: 14
Homologene: 10178
Ccdc60
Name: coiled-coil domain containing 60
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269693
Homologene: 18624
Lin54
Name: lin-54 DREAM MuvB core complex component
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231506
Homologene: 18212
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
Tent2
Name: terminal nucleotidyltransferase 2
Synonyms: 8030446C20Rik, Papd4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100715
VEGA: 13
Homologene: 44022
Adam12
Name: ADAM metallopeptidase domain 12
Synonyms: Mltna, ADAM12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11489
HGNC: HGNC:190
Homologene: 74862
Gbx2
Name: gastrulation brain homeobox 2
Synonyms: MMoxA, Gbx-2, Stra7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14472
HGNC: HGNC:4186
Homologene: 1138
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Cyp1a1
Name: cytochrome P450, family 1, subfamily a, polypeptide 1
Synonyms: cytochrome P450 subfamily I, polypeptide 1, P450-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13076
VEGA: 9
HGNC: HGNC:2595
Homologene: 68062
Olfm4
Name: olfactomedin 4
Synonyms: LOC380924, LOC239192, GC1, OlfD, GW112, pPD4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380924
VEGA: 14
Homologene: 4684
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Gdap2
Name: ganglioside-induced differentiation-associated-protein 2
Synonyms: D3Ertd801e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14547
Homologene: 7728
Mapk8ip3
Name: mitogen-activated protein kinase 8 interacting protein 3
Synonyms: JNK-interacting protein 3, Jip3, JSAP1, JUN/SAPK-associated protein 1, JSAP1d, JSAP1c, JSAP1b, JSAP1a, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, sunday driver 2, Syd2, D17Wsu15e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 30957
HGNC: HGNC:6884
Homologene: 22790
Pes1
Name: pescadillo ribosomal biogenesis factor 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 64934
HGNC: HGNC:8848
Homologene: 5984
Snrnp48
Name: small nuclear ribonucleoprotein 48 (U11/U12)
Synonyms: 1110050F08Rik, 6530403A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67797
VEGA: 13
Homologene: 12191
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Adar
Name: adenosine deaminase, RNA-specific
Synonyms: ADAR1, mZaADAR, Adar1p110, Adar1p150
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56417
HGNC: HGNC:225
Homologene: 9281
Abcb6
Name: ATP-binding cassette, sub-family B member 6
Synonyms: 1200005B17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74104
HGNC: HGNC:47
Homologene: 11375
Kcng3
Name: potassium voltage-gated channel, subfamily G, member 3
Synonyms: KV6.3, Kv10.1b, Kv10.1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225030
VEGA: 17
Homologene: 15168
Tpsb2
Name: tryptase beta 2
Synonyms: MMCP-6, Mcp-6, Mcpt6, Mcp6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17229
VEGA: 17
Homologene: 55729
Cox5b
Name: cytochrome c oxidase subunit 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12859
HGNC: HGNC:2269
Homologene: 133751
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Ttpal
Name: tocopherol (alpha) transfer protein-like
Synonyms: 3110080A02Rik, 5830472M02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76080
Homologene: 41562
Trim16
Name: tripartite motif-containing 16
Synonyms: EBBP, 9130006M08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94092
Homologene: 4726
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Mab21l4
Name: mab-21-like 4
Synonyms: 2310007B03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71874
Homologene: 11761
Slc27a2
Name: solute carrier family 27 (fatty acid transporter), member 2
Synonyms: FATP2, VLCS, FATP2, Vlacs, Vlac, ACSVL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26458
Homologene: 37830
Madd
Name: MAP-kinase activating death domain
Synonyms: 9630059K23Rik, Rab3 GEP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228355
HGNC: HGNC:6766
Homologene: 14249
1110002E22Rik
Name: RIKEN cDNA 1110002E22 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102634333
Homologene: 131709
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Png-1, Nztf1, Pmng1, C630034G21Rik, 2900093J19Rik, 2900046C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279029
Homologene: 19586
Dhx30
Name: DExH-box helicase 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Masp1
Name: MBL associated serine protease 1
Synonyms: Crarf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17174
VEGA: 16
HGNC: HGNC:6901
Homologene: 88793
Gsdma2
Name: gasdermin A2
Synonyms: 2210411P14Rik, 2210009F20Rik, 2200001G21Rik, Gsdml2, 2210006M16Rik, Gsdm2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76758
Nxpe3
Name: neurexophilin and PC-esterase domain family, member 3
Synonyms: LOC208684, LOC385658, Fam55c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385658
VEGA: 16
Homologene: 17030
Or10ak8
Name: olfactory receptor family 10 subfamily AK member 8
Synonyms: GA_x6K02T2QD9B-18619941-18620882, MOR259-2, Olfr1329
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258214
Homologene: 79401
Plekhh3
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217198
Homologene: 11787
Slc24a4
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 4
Synonyms: NCKX4, A930002M03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238384
Homologene: 17798
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Erbb2
Name: erb-b2 receptor tyrosine kinase 2
Synonyms: Neu, Neu oncogene, c-erbB2, HER-2, ErbB-2, HER2, c-neu, l11Jus8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13866
HGNC: HGNC:3430
Homologene: 3273
Lvrn
Name: laeverin
Synonyms: 4833403I15Rik, Aqpep
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74574
VEGA: 18
Homologene: 51352
Zfyve16
Name: zinc finger, FYVE domain containing 16
Synonyms: B130024H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218441
Homologene: 8826
Disc1
Name: disrupted in schizophrenia 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244667
HGNC: HGNC:2888
Homologene: 10257
Ccdc66
Name: coiled-coil domain containing 66
Synonyms: E230015L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 320234
VEGA: 14
Homologene: 35309
Vmn2r45
Name: vomeronasal 2, receptor 45
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042810
Homologene: 113703
Ccdc68
Name: coiled-coil domain containing 68
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381175
Homologene: 11880
Ccdc102a
Name: coiled-coil domain containing 102A
Synonyms: LOC234582
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234582
Homologene: 13240
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Aldh3a1
Name: aldehyde dehydrogenase family 3, subfamily A1
Synonyms: Ahd-4, Ahd4, Aldh3, Aldh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11670
HGNC: HGNC:405
Homologene: 20175
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Mgat5
Name: mannoside acetylglucosaminyltransferase 5
Synonyms: GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V, 5330407H02Rik, 4930471A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107895
HGNC: HGNC:7049
Homologene: 1808
Entrep3
Name: endosomal transmembrane epsin interactor 3
Synonyms: 1110013L07Rik, Fam189b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68521
HGNC: HGNC:1233
Homologene: 4805
Dcst1
Name: DC-STAMP domain containing 1
Synonyms: A330106H01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77772
Homologene: 14981
Ubox5
Name: U box domain containing 5
Synonyms: 1500010O06Rik, UIP5, C330018L13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140629
Homologene: 8972
Wdr81
Name: WD repeat domain 81
Synonyms: nur5, shakey 5, MGC32441
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Gsg1
Name: germ cell associated 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14840
Homologene: 7745
Gm20939
Name: predicted gene, 20939
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100044193
VEGA: 17
Trav6d-3
Name: T cell receptor alpha variable 6D-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 627394
Ighv1-62-1
Name: immunoglobulin heavy variable 1-62-1
Synonyms: Gm9232
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668544
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 36,691,678 bp (GRCm38)
  • T to C, chromosome 1 at 63,581,200 bp (GRCm38)
  • A to T, chromosome 1 at 75,174,728 bp (GRCm38)
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp (GRCm38)
  • T to C, chromosome 1 at 89,928,913 bp (GRCm38)
  • T to C, chromosome 1 at 93,159,846 bp (GRCm38)
  • A to G, chromosome 1 at 127,320,708 bp (GRCm38)
  • A to G, chromosome 1 at 131,344,426 bp (GRCm38)
  • T to C, chromosome 2 at 26,953,285 bp (GRCm38)
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp (GRCm38)
  • G to A, chromosome 2 at 91,175,681 bp (GRCm38)
  • A to G, chromosome 2 at 126,578,984 bp (GRCm38)
  • A to G, chromosome 2 at 130,599,915 bp (GRCm38)
  • A to G, chromosome 2 at 163,615,538 bp (GRCm38)
  • A to G, chromosome 2 at 166,941,466 bp (GRCm38)
  • A to G, chromosome 3 at 89,186,792 bp (GRCm38)
  • G to T, chromosome 3 at 89,357,768 bp (GRCm38)
  • A to G, chromosome 3 at 89,747,209 bp (GRCm38)
  • A to T, chromosome 3 at 100,170,948 bp (GRCm38)
  • A to G, chromosome 3 at 138,068,506 bp (GRCm38)
  • T to C, chromosome 4 at 49,638,751 bp (GRCm38)
  • C to T, chromosome 4 at 118,916,654 bp (GRCm38)
  • T to C, chromosome 5 at 17,714,454 bp (GRCm38)
  • T to A, chromosome 5 at 64,345,358 bp (GRCm38)
  • C to A, chromosome 5 at 100,450,687 bp (GRCm38)
  • C to A, chromosome 5 at 116,131,206 bp (GRCm38)
  • A to G, chromosome 6 at 72,153,596 bp (GRCm38)
  • C to T, chromosome 6 at 115,963,313 bp (GRCm38)
  • T to G, chromosome 6 at 135,240,100 bp (GRCm38)
  • T to A, chromosome 7 at 6,711,724 bp (GRCm38)
  • T to A, chromosome 7 at 8,475,458 bp (GRCm38)
  • T to C, chromosome 7 at 55,913,529 bp (GRCm38)
  • T to C, chromosome 7 at 85,155,733 bp (GRCm38)
  • A to G, chromosome 7 at 131,568,699 bp (GRCm38)
  • A to G, chromosome 7 at 133,964,725 bp (GRCm38)
  • C to A, chromosome 8 at 3,432,718 bp (GRCm38)
  • A to G, chromosome 8 at 94,913,273 bp (GRCm38)
  • A to T, chromosome 8 at 125,087,522 bp (GRCm38)
  • TG to TGG, chromosome 9 at 7,465,083 bp (GRCm38)
  • C to T, chromosome 9 at 57,700,487 bp (GRCm38)
  • T to C, chromosome 9 at 110,085,450 bp (GRCm38)
  • T to A, chromosome 10 at 127,574,377 bp (GRCm38)
  • A to G, chromosome 11 at 3,290,720 bp (GRCm38)
  • T to A, chromosome 11 at 3,976,118 bp (GRCm38)
  • G to A, chromosome 11 at 20,080,745 bp (GRCm38)
  • A to G, chromosome 11 at 49,215,715 bp (GRCm38)
  • A to G, chromosome 11 at 61,217,086 bp (GRCm38)
  • A to G, chromosome 11 at 62,840,818 bp (GRCm38)
  • A to G, chromosome 11 at 69,652,643 bp (GRCm38)
  • A to T, chromosome 11 at 75,453,523 bp (GRCm38)
  • A to T, chromosome 11 at 98,427,390 bp (GRCm38)
  • A to G, chromosome 11 at 98,649,633 bp (GRCm38)
  • G to A, chromosome 11 at 101,164,146 bp (GRCm38)
  • T to C, chromosome 12 at 29,893,442 bp (GRCm38)
  • C to T, chromosome 12 at 102,131,520 bp (GRCm38)
  • T to C, chromosome 12 at 115,386,981 bp (GRCm38)
  • T to C, chromosome 13 at 38,209,944 bp (GRCm38)
  • T to C, chromosome 13 at 92,500,255 bp (GRCm38)
  • G to T, chromosome 13 at 93,186,313 bp (GRCm38)
  • T to C, chromosome 14 at 27,497,424 bp (GRCm38)
  • A to G, chromosome 14 at 30,519,540 bp (GRCm38)
  • T to C, chromosome 14 at 33,133,471 bp (GRCm38)
  • G to A, chromosome 14 at 52,726,687 bp (GRCm38)
  • T to C, chromosome 14 at 80,006,307 bp (GRCm38)
  • A to T, chromosome 15 at 101,013,291 bp (GRCm38)
  • T to A, chromosome 16 at 23,452,948 bp (GRCm38)
  • A to T, chromosome 16 at 55,844,492 bp (GRCm38)
  • A to G, chromosome 16 at 84,730,471 bp (GRCm38)
  • C to A, chromosome 17 at 24,899,150 bp (GRCm38)
  • T to A, chromosome 17 at 25,367,103 bp (GRCm38)
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp (GRCm38)
  • A to T, chromosome 17 at 83,587,782 bp (GRCm38)
  • A to G, chromosome 17 at 94,877,238 bp (GRCm38)
  • A to C, chromosome 18 at 46,866,427 bp (GRCm38)
  • T to A, chromosome 18 at 62,950,198 bp (GRCm38)
  • A to G, chromosome 18 at 65,210,329 bp (GRCm38)
  • A to G, chromosome 18 at 67,835,454 bp (GRCm38)
  • A to G, chromosome 18 at 69,960,421 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9599 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069392-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.