Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9599Btlr/Mmmh
Stock Number:
069392-MU
Citation ID:
RRID:MMRRC_069392-MU
Other Names:
R9599 (G1)
Major Collection:

Strain Information

Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
St3gal5
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 5
Synonyms: ST3Gal V, mST3Gal V, GM3-specific sialytransferase, GM3 synthase, [a]2, 3S-T, Siat9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20454
Homologene: 2893
Mrpl39
Name: mitochondrial ribosomal protein L39
Synonyms: MRP-L5, Rpml5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27393
Homologene: 9679
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 36,691,678 bp (GRCm38)
  • T to C, chromosome 1 at 63,581,200 bp (GRCm38)
  • A to T, chromosome 1 at 75,174,728 bp (GRCm38)
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp (GRCm38)
  • T to C, chromosome 1 at 89,928,913 bp (GRCm38)
  • T to C, chromosome 1 at 93,159,846 bp (GRCm38)
  • A to G, chromosome 1 at 127,320,708 bp (GRCm38)
  • A to G, chromosome 1 at 131,344,426 bp (GRCm38)
  • T to C, chromosome 2 at 26,953,285 bp (GRCm38)
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp (GRCm38)
  • G to A, chromosome 2 at 91,175,681 bp (GRCm38)
  • A to G, chromosome 2 at 126,578,984 bp (GRCm38)
  • A to G, chromosome 2 at 130,599,915 bp (GRCm38)
  • A to G, chromosome 2 at 163,615,538 bp (GRCm38)
  • A to G, chromosome 2 at 166,941,466 bp (GRCm38)
  • A to G, chromosome 3 at 89,186,792 bp (GRCm38)
  • G to T, chromosome 3 at 89,357,768 bp (GRCm38)
  • A to G, chromosome 3 at 89,747,209 bp (GRCm38)
  • A to T, chromosome 3 at 100,170,948 bp (GRCm38)
  • A to G, chromosome 3 at 138,068,506 bp (GRCm38)
  • T to C, chromosome 4 at 49,638,751 bp (GRCm38)
  • C to T, chromosome 4 at 118,916,654 bp (GRCm38)
  • T to C, chromosome 5 at 17,714,454 bp (GRCm38)
  • T to A, chromosome 5 at 64,345,358 bp (GRCm38)
  • C to A, chromosome 5 at 100,450,687 bp (GRCm38)
  • C to A, chromosome 5 at 116,131,206 bp (GRCm38)
  • A to G, chromosome 6 at 72,153,596 bp (GRCm38)
  • C to T, chromosome 6 at 115,963,313 bp (GRCm38)
  • T to G, chromosome 6 at 135,240,100 bp (GRCm38)
  • T to A, chromosome 7 at 6,711,724 bp (GRCm38)
  • T to A, chromosome 7 at 8,475,458 bp (GRCm38)
  • T to C, chromosome 7 at 55,913,529 bp (GRCm38)
  • T to C, chromosome 7 at 85,155,733 bp (GRCm38)
  • A to G, chromosome 7 at 131,568,699 bp (GRCm38)
  • A to G, chromosome 7 at 133,964,725 bp (GRCm38)
  • C to A, chromosome 8 at 3,432,718 bp (GRCm38)
  • A to G, chromosome 8 at 94,913,273 bp (GRCm38)
  • A to T, chromosome 8 at 125,087,522 bp (GRCm38)
  • TG to TGG, chromosome 9 at 7,465,083 bp (GRCm38)
  • C to T, chromosome 9 at 57,700,487 bp (GRCm38)
  • T to C, chromosome 9 at 110,085,450 bp (GRCm38)
  • T to A, chromosome 10 at 127,574,377 bp (GRCm38)
  • A to G, chromosome 11 at 3,290,720 bp (GRCm38)
  • T to A, chromosome 11 at 3,976,118 bp (GRCm38)
  • G to A, chromosome 11 at 20,080,745 bp (GRCm38)
  • A to G, chromosome 11 at 49,215,715 bp (GRCm38)
  • A to G, chromosome 11 at 61,217,086 bp (GRCm38)
  • A to G, chromosome 11 at 62,840,818 bp (GRCm38)
  • A to G, chromosome 11 at 69,652,643 bp (GRCm38)
  • A to T, chromosome 11 at 75,453,523 bp (GRCm38)
  • A to T, chromosome 11 at 98,427,390 bp (GRCm38)
  • A to G, chromosome 11 at 98,649,633 bp (GRCm38)
  • G to A, chromosome 11 at 101,164,146 bp (GRCm38)
  • T to C, chromosome 12 at 29,893,442 bp (GRCm38)
  • C to T, chromosome 12 at 102,131,520 bp (GRCm38)
  • T to C, chromosome 12 at 115,386,981 bp (GRCm38)
  • T to C, chromosome 13 at 38,209,944 bp (GRCm38)
  • T to C, chromosome 13 at 92,500,255 bp (GRCm38)
  • G to T, chromosome 13 at 93,186,313 bp (GRCm38)
  • T to C, chromosome 14 at 27,497,424 bp (GRCm38)
  • A to G, chromosome 14 at 30,519,540 bp (GRCm38)
  • T to C, chromosome 14 at 33,133,471 bp (GRCm38)
  • G to A, chromosome 14 at 52,726,687 bp (GRCm38)
  • T to C, chromosome 14 at 80,006,307 bp (GRCm38)
  • A to T, chromosome 15 at 101,013,291 bp (GRCm38)
  • T to A, chromosome 16 at 23,452,948 bp (GRCm38)
  • A to T, chromosome 16 at 55,844,492 bp (GRCm38)
  • A to G, chromosome 16 at 84,730,471 bp (GRCm38)
  • C to A, chromosome 17 at 24,899,150 bp (GRCm38)
  • T to A, chromosome 17 at 25,367,103 bp (GRCm38)
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp (GRCm38)
  • A to T, chromosome 17 at 83,587,782 bp (GRCm38)
  • A to G, chromosome 17 at 94,877,238 bp (GRCm38)
  • A to C, chromosome 18 at 46,866,427 bp (GRCm38)
  • T to A, chromosome 18 at 62,950,198 bp (GRCm38)
  • A to G, chromosome 18 at 65,210,329 bp (GRCm38)
  • A to G, chromosome 18 at 67,835,454 bp (GRCm38)
  • A to G, chromosome 18 at 69,960,421 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9599 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069392-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.