Strain Name:
C57BL/6J-MtgxR9616Btlr/Mmmh
Stock Number:
069409-MU
Citation ID:
RRID:MMRRC_069409-MU
Other Names:
R9616 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Lpp
Name: LIM domain containing preferred translocation partner in lipoma
Synonyms: B130055L10Rik, 9430020K16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 210126
VEGA: 16
HGNC: HGNC:6679
Homologene: 4075
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Knl1
Name: kinetochore scaffold 1
Synonyms: 2310043D08Rik, 5730505K17Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Gabpa
Name: GA repeat binding protein, alpha
Synonyms: GABPalpha
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14390
HGNC: HGNC:4071
Homologene: 1543
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Sdhaf2
Name: succinate dehydrogenase complex assembly factor 2
Synonyms: 0610038F07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66072
VEGA: 19
Homologene: 32370
Otof
Name: otoferlin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83762
HGNC: HGNC:8515
Homologene: 12892
Etv6
Name: ets variant 6
Synonyms: Tel, translocation-ets-leukemia
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14011
HGNC: HGNC:3495
Homologene: 37560
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
Fbxl5
Name: F-box and leucine-rich repeat protein 5
Synonyms: Fir4, Fbl4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242960
Homologene: 8129
Cnp
Name: 2',3'-cyclic nucleotide 3' phosphodiesterase
Synonyms: Cnp-1, CNPase, Cnp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12799
HGNC: HGNC:2158
Homologene: 7672
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Tcgap, Snx26, NOMA-GAP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Cldn18
Name: claudin 18
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56492
HGNC: HGNC:2039
Homologene: 9489
Il17b
Name: interleukin 17B
Synonyms: Zcyto7, 1110006O16Rik, 1700006N07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56069
VEGA: 18
HGNC: HGNC:5982
Homologene: 8689
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Per1
Name: period circadian clock 1
Synonyms: m-rigui, mPer1, Hftm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18626
HGNC: HGNC:8845
Homologene: 1966
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24116
Homologene: 68478
Rnf13
Name: ring finger protein 13
Synonyms: Rzf, 2010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24017
Homologene: 13493
Zbtb10
Name: zinc finger and BTB domain containing 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229055
Homologene: 11395
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: Bromi, C6orf170, D630037F22Rik, b2b2284Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Kdm2a
Name: lysine (K)-specific demethylase 2A
Synonyms: Cxxc8, Fbl7, lalina, Jhdm1a, Fbxl11, Gm4560, 5530401A10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225876
Homologene: 56564
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Myof
Name: myoferlin
Synonyms: 2310051D19Rik, E030042N20Rik, Fer1l3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226101
VEGA: 19
HGNC: HGNC:3656
Homologene: 40882
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Tab2
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: 1110030N06Rik, Tak1 binding protein 2, A530078N03Rik, Map3k7ip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68652
Homologene: 9019
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Ms4a10
Name: membrane-spanning 4-domains, subfamily A, member 10
Synonyms: 2010001N17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69826
Homologene: 11355
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: Arhgap14, D130026O08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259302
Homologene: 56686
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Vmn2r6
Name: vomeronasal 2, receptor 6
Synonyms: EG620718, EG667069
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667069
Homologene: 129754
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57775
Homologene: 49641
Dclk1
Name: doublecortin-like kinase 1
Synonyms: CPG16, DCLK, 1700113D08Rik, 2810480F11Rik, Dcl, Click-I, Dcamkl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13175
HGNC: HGNC:2700
Homologene: 130530
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Nek11
Name: NIMA (never in mitosis gene a)-related expressed kinase 11
Synonyms: 4932416N14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208583
Homologene: 57008
Kdm1b
Name: lysine (K)-specific demethylase 1B
Synonyms: 4632428N09Rik, Aof1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218214
Homologene: 14695
Cgn
Name: cingulin
Synonyms: 6330408J11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70737
Homologene: 41394
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Vmn2r59
Name: vomeronasal 2, receptor 59
Synonyms: EG628444
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628444
Homologene: 129683
Pitrm1
Name: pitrilysin metallepetidase 1
Synonyms: 2310012C15Rik, MP-1, Ntup1, PreP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69617
VEGA: 13
Homologene: 5742
Cntn4
Name: contactin 4
Synonyms: BIG-2A, Axcam
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269784
HGNC: HGNC:2174
Homologene: 14257
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Slc1a4
Name: solute carrier family 1 (glutamate/neutral amino acid transporter), member 4
Synonyms: ASCT1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55963
Homologene: 20655
Cyp2c39
Name: cytochrome P450, family 2, subfamily c, polypeptide 39
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13098
Homologene: 117948
Fhl2
Name: four and a half LIM domains 2
Synonyms: SLIM3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14200
HGNC: HGNC:3703
Homologene: 20372
Capn13
Name: calpain 13
Synonyms: LOC381122
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381122
VEGA: 17
Homologene: 27026
Mertk
Name: MER proto-oncogene tyrosine kinase
Synonyms: Tyro 12, Nyk, Eyk, Mer, nmf12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17289
HGNC: HGNC:7027
Homologene: 4626
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Sntg2
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268534
Homologene: 41298
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Lrrc15
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74488
Homologene: 26080
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Or52b2
Name: olfactory receptor family 52 subfamily B member 2
Synonyms: GA_x6K02T2PBJ9-7966695-7965727, MOR31-6, Olfr691
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259063
Homologene: 17483
Fbxo11
Name: F-box protein 11
Synonyms: GENA 104, Jf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225055
Homologene: 11843
Klk1b9
Name: kallikrein 1-related peptidase b9
Synonyms: mGk-9, Egfbp-3, Egfbp3, Klk9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13648
Homologene: 68141
Tnni3k
Name: TNNI3 interacting kinase
Synonyms: Cark, D830019J24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 435766
Homologene: 41084
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Notum
Name: notum palmitoleoyl-protein carboxylesterase
Synonyms: 5730593N15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77583
Homologene: 45335
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77629
Homologene: 18172
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 636808
Homologene: 43974
Xylb
Name: xylulokinase homolog (H. influenzae)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102448
VEGA: 9
Homologene: 3746
Ceacam3
Name: CEA cell adhesion molecule 3
Synonyms: cea12, EG384557, Psg24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384557
HGNC: HGNC:1819
Homologene: 86971
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Dpp4
Name: dipeptidylpeptidase 4
Synonyms: THAM, Dpp-4, Cd26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13482
HGNC: HGNC:3009
Homologene: 3279
Zfp78
Name: zinc finger protein 78
Synonyms: KRAB12, Zfp77
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330463
Homologene: 128524
Or9i16
Name: olfactory receptor family 9 subfamily I member 16
Synonyms: GA_x6K02T2RE5P-4223635-4222688, MOR212-2, Olfr1504
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258627
Homologene: 45020
Otud3
Name: OTU domain containing 3
Synonyms: 3110030K17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73162
Homologene: 66103
Tekt4
Name: tektin 4
Synonyms: 1700010L19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71840
Homologene: 25745
Acsm4
Name: acyl-CoA synthetase medium-chain family member 4
Synonyms: O-MACS, OMACS
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233801
Homologene: 72281
Or13c7d
Name: olfactory receptor family 13 subfamily C member 7D
Synonyms: mOR37e, Olfr37e, GA_x6K02T2N78B-16165641-16166600, MOR262-5, Olfr159
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29849
Homologene: 128097
Zfp263
Name: zinc finger protein 263
Synonyms: 1200014J04Rik, NT2, mFPM315
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74120
Homologene: 4197
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Prl3a1
Name: prolactin family 3, subfamily a, member 1
Synonyms: PLP-H, PLP-I, 1600016E11Rik, Plpi, Prlpi
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67000
Homologene: 49844
Pycard
Name: PYD and CARD domain containing
Synonyms: TMS-1, 9130417A21Rik, Asc
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66824
Homologene: 8307
Mpst
Name: mercaptopyruvate sulfurtransferase
Synonyms: 3MST
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 246221
VEGA: 15
HGNC: HGNC:7223
Homologene: 31942
Sgo2b
Name: shugoshin 2B
Synonyms: Gm4975, Sgol2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244495
Homologene: 51867
Inha
Name: inhibin alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16322
HGNC: HGNC:6065
Homologene: 1652
3110040M04Rik
Name: RIKEN cDNA 3110040M04 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73176
VEGA: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 14,918,853 bp (GRCm38)
  • G to T, chromosome 1 at 43,128,386 bp (GRCm38)
  • C to T, chromosome 1 at 58,228,861 bp (GRCm38)
  • T to A, chromosome 1 at 75,509,567 bp (GRCm38)
  • T to C, chromosome 1 at 83,277,268 bp (GRCm38)
  • T to C, chromosome 1 at 87,428,604 bp (GRCm38)
  • T to C, chromosome 1 at 116,101,593 bp (GRCm38)
  • T to A, chromosome 1 at 131,325,090 bp (GRCm38)
  • A to T, chromosome 1 at 140,102,516 bp (GRCm38)
  • T to G, chromosome 1 at 150,808,722 bp (GRCm38)
  • T to A, chromosome 1 at 151,204,729 bp (GRCm38)
  • T to C, chromosome 1 at 151,636,442 bp (GRCm38)
  • A to G, chromosome 2 at 13,314,718 bp (GRCm38)
  • T to C, chromosome 2 at 62,387,085 bp (GRCm38)
  • T to C, chromosome 2 at 119,069,513 bp (GRCm38)
  • A to T, chromosome 2 at 119,076,944 bp (GRCm38)
  • A to C, chromosome 2 at 121,236,176 bp (GRCm38)
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp (GRCm38)
  • C to T, chromosome 2 at 128,801,335 bp (GRCm38)
  • C to T, chromosome 3 at 9,251,413 bp (GRCm38)
  • G to A, chromosome 3 at 55,480,433 bp (GRCm38)
  • A to G, chromosome 3 at 57,833,009 bp (GRCm38)
  • A to G, chromosome 3 at 64,538,303 bp (GRCm38)
  • A to G, chromosome 3 at 94,763,025 bp (GRCm38)
  • G to A, chromosome 3 at 154,962,087 bp (GRCm38)
  • T to A, chromosome 4 at 43,770,193 bp (GRCm38)
  • A to G, chromosome 4 at 138,897,614 bp (GRCm38)
  • A to G, chromosome 4 at 145,098,131 bp (GRCm38)
  • A to G, chromosome 5 at 8,812,779 bp (GRCm38)
  • A to G, chromosome 5 at 30,382,364 bp (GRCm38)
  • G to A, chromosome 5 at 33,901,783 bp (GRCm38)
  • A to G, chromosome 5 at 43,758,817 bp (GRCm38)
  • T to A, chromosome 6 at 106,697,564 bp (GRCm38)
  • A to T, chromosome 6 at 112,771,563 bp (GRCm38)
  • A to G, chromosome 6 at 134,266,332 bp (GRCm38)
  • A to G, chromosome 7 at 6,379,079 bp (GRCm38)
  • A to G, chromosome 7 at 6,963,180 bp (GRCm38)
  • G to A, chromosome 7 at 17,158,153 bp (GRCm38)
  • A to G, chromosome 7 at 30,529,942 bp (GRCm38)
  • T to C, chromosome 7 at 42,011,875 bp (GRCm38)
  • G to T, chromosome 7 at 43,979,371 bp (GRCm38)
  • T to G, chromosome 7 at 64,208,384 bp (GRCm38)
  • A to C, chromosome 7 at 105,337,313 bp (GRCm38)
  • A to G, chromosome 7 at 119,694,649 bp (GRCm38)
  • C to T, chromosome 7 at 127,993,604 bp (GRCm38)
  • G to GA, chromosome 8 at 25,913,647 bp (GRCm38)
  • C to A, chromosome 8 at 44,953,038 bp (GRCm38)
  • T to C, chromosome 8 at 61,020,073 bp (GRCm38)
  • C to T, chromosome 8 at 63,927,240 bp (GRCm38)
  • T to C, chromosome 9 at 99,698,862 bp (GRCm38)
  • T to A, chromosome 9 at 105,204,812 bp (GRCm38)
  • T to A, chromosome 9 at 119,371,956 bp (GRCm38)
  • A to T, chromosome 10 at 7,919,241 bp (GRCm38)
  • T to C, chromosome 10 at 56,161,150 bp (GRCm38)
  • T to A, chromosome 11 at 4,939,443 bp (GRCm38)
  • A to T, chromosome 11 at 9,290,501 bp (GRCm38)
  • C to T, chromosome 11 at 11,822,288 bp (GRCm38)
  • T to C, chromosome 11 at 20,332,403 bp (GRCm38)
  • G to T, chromosome 11 at 69,102,728 bp (GRCm38)
  • G to A, chromosome 11 at 100,576,435 bp (GRCm38)
  • C to T, chromosome 11 at 101,525,857 bp (GRCm38)
  • A to G, chromosome 11 at 113,800,235 bp (GRCm38)
  • G to T, chromosome 11 at 120,660,148 bp (GRCm38)
  • A to T, chromosome 12 at 16,740,037 bp (GRCm38)
  • T to C, chromosome 12 at 30,276,733 bp (GRCm38)
  • G to T, chromosome 13 at 6,555,566 bp (GRCm38)
  • C to T, chromosome 13 at 27,275,135 bp (GRCm38)
  • A to G, chromosome 13 at 47,080,554 bp (GRCm38)
  • T to C, chromosome 14 at 31,304,443 bp (GRCm38)
  • A to G, chromosome 15 at 73,568,714 bp (GRCm38)
  • T to A, chromosome 15 at 78,410,161 bp (GRCm38)
  • C to T, chromosome 16 at 3,749,618 bp (GRCm38)
  • T to C, chromosome 16 at 24,761,969 bp (GRCm38)
  • A to G, chromosome 16 at 30,273,699 bp (GRCm38)
  • T to C, chromosome 16 at 37,215,952 bp (GRCm38)
  • T to C, chromosome 16 at 81,443,254 bp (GRCm38)
  • T to A, chromosome 16 at 84,852,573 bp (GRCm38)
  • G to A, chromosome 16 at 85,862,786 bp (GRCm38)
  • G to A, chromosome 16 at 91,853,167 bp (GRCm38)
  • T to A, chromosome 17 at 18,136,043 bp (GRCm38)
  • T to C, chromosome 17 at 25,473,808 bp (GRCm38)
  • T to A, chromosome 17 at 73,365,969 bp (GRCm38)
  • T to C, chromosome 17 at 81,647,978 bp (GRCm38)
  • T to A, chromosome 17 at 88,008,670 bp (GRCm38)
  • A to G, chromosome 18 at 61,692,292 bp (GRCm38)
  • A to G, chromosome 18 at 65,656,568 bp (GRCm38)
  • A to T, chromosome 19 at 4,320,280 bp (GRCm38)
  • T to C, chromosome 19 at 10,517,325 bp (GRCm38)
  • T to C, chromosome 19 at 10,967,076 bp (GRCm38)
  • A to G, chromosome 19 at 13,887,497 bp (GRCm38)
  • A to G, chromosome 19 at 37,934,815 bp (GRCm38)
  • T to A, chromosome 19 at 39,513,204 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9616 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069409-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.