Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9616Btlr/Mmmh
Stock Number:
069409-MU
Citation ID:
RRID:MMRRC_069409-MU
Other Names:
R9616 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Lpp
Name: LIM domain containing preferred translocation partner in lipoma
Synonyms: B130055L10Rik, 9430020K16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 210126
VEGA: 16
HGNC: HGNC:6679
Homologene: 4075
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 14,918,853 bp (GRCm38)
  • G to T, chromosome 1 at 43,128,386 bp (GRCm38)
  • C to T, chromosome 1 at 58,228,861 bp (GRCm38)
  • T to A, chromosome 1 at 75,509,567 bp (GRCm38)
  • T to C, chromosome 1 at 83,277,268 bp (GRCm38)
  • T to C, chromosome 1 at 87,428,604 bp (GRCm38)
  • T to C, chromosome 1 at 116,101,593 bp (GRCm38)
  • T to A, chromosome 1 at 131,325,090 bp (GRCm38)
  • A to T, chromosome 1 at 140,102,516 bp (GRCm38)
  • T to G, chromosome 1 at 150,808,722 bp (GRCm38)
  • T to A, chromosome 1 at 151,204,729 bp (GRCm38)
  • T to C, chromosome 1 at 151,636,442 bp (GRCm38)
  • A to G, chromosome 2 at 13,314,718 bp (GRCm38)
  • T to C, chromosome 2 at 62,387,085 bp (GRCm38)
  • T to C, chromosome 2 at 119,069,513 bp (GRCm38)
  • A to T, chromosome 2 at 119,076,944 bp (GRCm38)
  • A to C, chromosome 2 at 121,236,176 bp (GRCm38)
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp (GRCm38)
  • C to T, chromosome 2 at 128,801,335 bp (GRCm38)
  • C to T, chromosome 3 at 9,251,413 bp (GRCm38)
  • G to A, chromosome 3 at 55,480,433 bp (GRCm38)
  • A to G, chromosome 3 at 57,833,009 bp (GRCm38)
  • A to G, chromosome 3 at 64,538,303 bp (GRCm38)
  • A to G, chromosome 3 at 94,763,025 bp (GRCm38)
  • G to A, chromosome 3 at 154,962,087 bp (GRCm38)
  • T to A, chromosome 4 at 43,770,193 bp (GRCm38)
  • A to G, chromosome 4 at 138,897,614 bp (GRCm38)
  • A to G, chromosome 4 at 145,098,131 bp (GRCm38)
  • A to G, chromosome 5 at 8,812,779 bp (GRCm38)
  • A to G, chromosome 5 at 30,382,364 bp (GRCm38)
  • G to A, chromosome 5 at 33,901,783 bp (GRCm38)
  • A to G, chromosome 5 at 43,758,817 bp (GRCm38)
  • T to A, chromosome 6 at 106,697,564 bp (GRCm38)
  • A to T, chromosome 6 at 112,771,563 bp (GRCm38)
  • A to G, chromosome 6 at 134,266,332 bp (GRCm38)
  • A to G, chromosome 7 at 6,379,079 bp (GRCm38)
  • A to G, chromosome 7 at 6,963,180 bp (GRCm38)
  • G to A, chromosome 7 at 17,158,153 bp (GRCm38)
  • A to G, chromosome 7 at 30,529,942 bp (GRCm38)
  • T to C, chromosome 7 at 42,011,875 bp (GRCm38)
  • G to T, chromosome 7 at 43,979,371 bp (GRCm38)
  • T to G, chromosome 7 at 64,208,384 bp (GRCm38)
  • A to C, chromosome 7 at 105,337,313 bp (GRCm38)
  • A to G, chromosome 7 at 119,694,649 bp (GRCm38)
  • C to T, chromosome 7 at 127,993,604 bp (GRCm38)
  • G to GA, chromosome 8 at 25,913,647 bp (GRCm38)
  • C to A, chromosome 8 at 44,953,038 bp (GRCm38)
  • T to C, chromosome 8 at 61,020,073 bp (GRCm38)
  • C to T, chromosome 8 at 63,927,240 bp (GRCm38)
  • T to C, chromosome 9 at 99,698,862 bp (GRCm38)
  • T to A, chromosome 9 at 105,204,812 bp (GRCm38)
  • T to A, chromosome 9 at 119,371,956 bp (GRCm38)
  • A to T, chromosome 10 at 7,919,241 bp (GRCm38)
  • T to C, chromosome 10 at 56,161,150 bp (GRCm38)
  • T to A, chromosome 11 at 4,939,443 bp (GRCm38)
  • A to T, chromosome 11 at 9,290,501 bp (GRCm38)
  • C to T, chromosome 11 at 11,822,288 bp (GRCm38)
  • T to C, chromosome 11 at 20,332,403 bp (GRCm38)
  • G to T, chromosome 11 at 69,102,728 bp (GRCm38)
  • G to A, chromosome 11 at 100,576,435 bp (GRCm38)
  • C to T, chromosome 11 at 101,525,857 bp (GRCm38)
  • A to G, chromosome 11 at 113,800,235 bp (GRCm38)
  • G to T, chromosome 11 at 120,660,148 bp (GRCm38)
  • A to T, chromosome 12 at 16,740,037 bp (GRCm38)
  • T to C, chromosome 12 at 30,276,733 bp (GRCm38)
  • G to T, chromosome 13 at 6,555,566 bp (GRCm38)
  • C to T, chromosome 13 at 27,275,135 bp (GRCm38)
  • A to G, chromosome 13 at 47,080,554 bp (GRCm38)
  • T to C, chromosome 14 at 31,304,443 bp (GRCm38)
  • A to G, chromosome 15 at 73,568,714 bp (GRCm38)
  • T to A, chromosome 15 at 78,410,161 bp (GRCm38)
  • C to T, chromosome 16 at 3,749,618 bp (GRCm38)
  • T to C, chromosome 16 at 24,761,969 bp (GRCm38)
  • A to G, chromosome 16 at 30,273,699 bp (GRCm38)
  • T to C, chromosome 16 at 37,215,952 bp (GRCm38)
  • T to C, chromosome 16 at 81,443,254 bp (GRCm38)
  • T to A, chromosome 16 at 84,852,573 bp (GRCm38)
  • G to A, chromosome 16 at 85,862,786 bp (GRCm38)
  • G to A, chromosome 16 at 91,853,167 bp (GRCm38)
  • T to A, chromosome 17 at 18,136,043 bp (GRCm38)
  • T to C, chromosome 17 at 25,473,808 bp (GRCm38)
  • T to A, chromosome 17 at 73,365,969 bp (GRCm38)
  • T to C, chromosome 17 at 81,647,978 bp (GRCm38)
  • T to A, chromosome 17 at 88,008,670 bp (GRCm38)
  • A to G, chromosome 18 at 61,692,292 bp (GRCm38)
  • A to G, chromosome 18 at 65,656,568 bp (GRCm38)
  • A to T, chromosome 19 at 4,320,280 bp (GRCm38)
  • T to C, chromosome 19 at 10,517,325 bp (GRCm38)
  • T to C, chromosome 19 at 10,967,076 bp (GRCm38)
  • A to G, chromosome 19 at 13,887,497 bp (GRCm38)
  • A to G, chromosome 19 at 37,934,815 bp (GRCm38)
  • T to A, chromosome 19 at 39,513,204 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9616 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069409-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.