Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9618Btlr/Mmmh
Stock Number:
069411-MU
Citation ID:
RRID:MMRRC_069411-MU
Other Names:
R9618 (G1)
Major Collection:

Strain Information

Pygb
Name: brain glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110078
HGNC: HGNC:9723
Homologene: 100930
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Eefsec
Name: eukaryotic elongation factor, selenocysteine-tRNA-specific
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 65967
Homologene: 11073
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Tpr
Name: translocated promoter region, nuclear basket protein
Synonyms: 2610029M07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108989
Homologene: 37753
Ergic1
Name: endoplasmic reticulum-golgi intermediate compartment 1
Synonyms: 1200007D18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67458
Homologene: 41667
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Esf1
Name: ESF1 nucleolar pre-rRNA processing protein homolog
Synonyms: 2610101J03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66580
Homologene: 5717
Mtmr2
Name: myotubularin related protein 2
Synonyms: 6030445P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77116
HGNC: HGNC:7450
Homologene: 22951
Ino80d
Name: INO80 complex subunit D
Synonyms: A430093A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227195
Homologene: 9819
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Or4m1
Name: olfactory receptor family 4 subfamily M member 1
Synonyms: GA_x6K02T2PMLR-6013665-6012724, MOR242-1, Olfr734
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258658
Homologene: 51759
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242553
Homologene: 18244
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Kcna4
Name: potassium voltage-gated channel, shaker-related subfamily, member 4
Synonyms: Kv1.4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16492
HGNC: HGNC:6222
Homologene: 20514
Wnt16
Name: wingless-type MMTV integration site family, member 16
Synonyms: E130309I19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93735
Homologene: 62175
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Nxph1
Name: neurexophilin 1
Synonyms: C130005L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18231
Homologene: 8284
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627537
Homologene: 129750
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Or4c35
Name: olfactory receptor family 4 subfamily C member 35
Synonyms: GA_x6K02T2Q125-51409740-51410672, MOR232-2, Olfr1260
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258983
Homologene: 17455
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
4930562C15Rik
Name: RIKEN cDNA 4930562C15 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78809
Homologene: 53527
P2ry14
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: A330108O13Rik, P2Y14, Gpr105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140795
Homologene: 15769
Vmn1r228
Name: vomeronasal 1 receptor 228
Synonyms: V1re3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171226
Homologene: 74320
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Xkr4
Name: X-linked Kx blood group related 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 497097
Homologene: 45848
Gabrp
Name: gamma-aminobutyric acid type A receptor subunit pi
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216643
HGNC: HGNC:4089
Homologene: 22798
Kcnip3
Name: Kv channel interacting protein 3, calsenilin
Synonyms: DREAM, 4933407H12Rik, KChIP3, R74849, Csen
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56461
Homologene: 8382
Slc15a5
Name: solute carrier family 15, member 5
Synonyms: 9830102E05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 277898
Homologene: 65333
Tmem256
Name: transmembrane protein 256
Synonyms: 3110009M16Rik, 1810027O10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69186
Homologene: 45148
Zfp683
Name: zinc finger protein 683
Synonyms: Hobit
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100503878
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68655
Pcare
Name: photoreceptor cilium actin regulator
Synonyms: BC027072
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225004
VEGA: 17
Homologene: 19792
Cryzl2
Name: crystallin zeta like 2
Synonyms: quinone reductase-like 2, BC026585
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226527
Homologene: 41713
Or7e176
Name: olfactory receptor family 7 subfamily E member 176
Synonyms: GA_x6K02T2PVTD-13999915-14000844, MOR145-3, Olfr872
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258553
HGNC: HGNC:8396
Homologene: 138312
Cfc1
Name: cryptic, EGF-CFC family member 1
Synonyms: cryptic, b2b970Clo
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12627
Homologene: 50007
Obox1
Name: oocyte specific homeobox 1
Synonyms: 7420700M11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71468
Homologene: 44937
1110032F04Rik
Name: RIKEN cDNA 1110032F04 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68725
Homologene: 110165
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Cln6
Name: ceroid-lipofuscinosis, neuronal 6
Synonyms: 1810065L06Rik, D9Bwg1455e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76524
HGNC: HGNC:2077
Homologene: 9898
2510039O18Rik
Name: RIKEN cDNA 2510039O18 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77034
Homologene: 12668
Trub2
Name: TruB pseudouridine (psi) synthase family member 2
Synonyms: G430055L02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227682
Homologene: 41056
Hdac1-ps
Name: histone deacetylase 1, pseudogene
Synonyms: EG15181, Gm10093
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15181
VEGA: 17
Hadha
Name: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha
Synonyms: Mtpa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 97212
HGNC: HGNC:4801
Homologene: 152
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 3,670,978 bp (GRCm38)
  • T to C, chromosome 1 at 34,536,479 bp (GRCm38)
  • G to A, chromosome 1 at 63,062,183 bp (GRCm38)
  • A to G, chromosome 1 at 67,157,816 bp (GRCm38)
  • G to T, chromosome 1 at 150,446,228 bp (GRCm38)
  • G to A, chromosome 1 at 157,462,008 bp (GRCm38)
  • A to T, chromosome 2 at 29,783,334 bp (GRCm38)
  • A to T, chromosome 2 at 89,977,999 bp (GRCm38)
  • T to A, chromosome 2 at 107,296,029 bp (GRCm38)
  • G to T, chromosome 2 at 127,510,892 bp (GRCm38)
  • T to C, chromosome 2 at 140,159,794 bp (GRCm38)
  • C to T, chromosome 2 at 150,815,088 bp (GRCm38)
  • T to A, chromosome 3 at 59,115,830 bp (GRCm38)
  • T to A, chromosome 3 at 64,271,303 bp (GRCm38)
  • C to T, chromosome 3 at 68,870,069 bp (GRCm38)
  • C to A, chromosome 4 at 73,950,697 bp (GRCm38)
  • A to T, chromosome 4 at 96,525,848 bp (GRCm38)
  • T to C, chromosome 4 at 98,765,495 bp (GRCm38)
  • A to T, chromosome 4 at 134,055,654 bp (GRCm38)
  • T to A, chromosome 4 at 147,945,416 bp (GRCm38)
  • G to A, chromosome 5 at 30,134,167 bp (GRCm38)
  • A to G, chromosome 5 at 76,856,770 bp (GRCm38)
  • T to G, chromosome 6 at 9,247,108 bp (GRCm38)
  • T to A, chromosome 6 at 22,297,892 bp (GRCm38)
  • G to T, chromosome 6 at 22,297,893 bp (GRCm38)
  • T to C, chromosome 6 at 88,297,699 bp (GRCm38)
  • A to T, chromosome 6 at 138,055,781 bp (GRCm38)
  • A to G, chromosome 7 at 15,555,699 bp (GRCm38)
  • G to GACGGCGGCC, chromosome 7 at 97,579,909 bp (GRCm38)
  • A to G, chromosome 8 at 12,984,320 bp (GRCm38)
  • A to G, chromosome 8 at 33,572,369 bp (GRCm38)
  • T to C, chromosome 9 at 13,796,019 bp (GRCm38)
  • G to A, chromosome 9 at 20,260,343 bp (GRCm38)
  • T to C, chromosome 9 at 62,850,829 bp (GRCm38)
  • T to C, chromosome 9 at 122,856,723 bp (GRCm38)
  • A to C, chromosome 10 at 41,327,631 bp (GRCm38)
  • A to G, chromosome 10 at 76,352,960 bp (GRCm38)
  • T to C, chromosome 11 at 8,961,420 bp (GRCm38)
  • A to T, chromosome 11 at 33,554,342 bp (GRCm38)
  • T to A, chromosome 11 at 69,839,384 bp (GRCm38)
  • T to C, chromosome 11 at 73,120,345 bp (GRCm38)
  • A to T, chromosome 14 at 50,320,303 bp (GRCm38)
  • G to T, chromosome 14 at 75,330,102 bp (GRCm38)
  • A to T, chromosome 16 at 4,849,554 bp (GRCm38)
  • T to G, chromosome 16 at 20,733,628 bp (GRCm38)
  • T to A, chromosome 17 at 7,771,481 bp (GRCm38)
  • A to T, chromosome 17 at 19,522,321 bp (GRCm38)
  • T to C, chromosome 17 at 20,776,783 bp (GRCm38)
  • G to A, chromosome 17 at 26,608,645 bp (GRCm38)
  • GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG to GGGGTGGG, chromosome 17 at 35,622,043 bp (GRCm38)
  • T to A, chromosome 17 at 71,750,822 bp (GRCm38)
  • T to C, chromosome 17 at 78,491,685 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9618 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069411-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.