Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9621Btlr/Mmmh
Stock Number:
069414-MU
Citation ID:
RRID:MMRRC_069414-MU
Other Names:
R9621 (G1)
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Ubc
Name: ubiquitin C
Synonyms: 2700054O04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22190
Homologene: 128418
Cfdp1
Name: craniofacial development protein 1
Synonyms: cp27, Bucentaur, Bcnt
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23837
HGNC: HGNC:1873
Homologene: 4611
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Pmpca
Name: peptidase (mitochondrial processing) alpha
Synonyms: INPP5E, Alpha-MPP, 4933435E07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66865
Homologene: 6078
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp (GRCm38)
  • A to G, chromosome 1 at 63,303,476 bp (GRCm38)
  • G to A, chromosome 1 at 93,055,723 bp (GRCm38)
  • T to C, chromosome 1 at 121,561,403 bp (GRCm38)
  • T to C, chromosome 1 at 133,071,607 bp (GRCm38)
  • TG to T, chromosome 1 at 155,795,389 bp (GRCm38)
  • A to T, chromosome 2 at 9,918,259 bp (GRCm38)
  • A to T, chromosome 2 at 11,256,203 bp (GRCm38)
  • A to T, chromosome 2 at 25,236,188 bp (GRCm38)
  • A to G, chromosome 2 at 26,389,976 bp (GRCm38)
  • A to G, chromosome 2 at 35,160,266 bp (GRCm38)
  • T to C, chromosome 2 at 75,937,800 bp (GRCm38)
  • T to C, chromosome 2 at 76,918,097 bp (GRCm38)
  • G to A, chromosome 2 at 83,812,765 bp (GRCm38)
  • G to A, chromosome 2 at 92,915,230 bp (GRCm38)
  • C to G, chromosome 2 at 119,450,015 bp (GRCm38)
  • A to T, chromosome 2 at 168,182,743 bp (GRCm38)
  • T to A, chromosome 2 at 178,470,190 bp (GRCm38)
  • T to A, chromosome 3 at 96,176,799 bp (GRCm38)
  • A to G, chromosome 3 at 100,684,645 bp (GRCm38)
  • A to T, chromosome 3 at 133,488,006 bp (GRCm38)
  • T to C, chromosome 4 at 53,092,918 bp (GRCm38)
  • T to A, chromosome 4 at 99,726,894 bp (GRCm38)
  • C to T, chromosome 4 at 107,292,361 bp (GRCm38)
  • C to T, chromosome 4 at 126,323,651 bp (GRCm38)
  • A to T, chromosome 5 at 37,117,468 bp (GRCm38)
  • G to A, chromosome 5 at 72,122,020 bp (GRCm38)
  • C to A, chromosome 5 at 88,380,346 bp (GRCm38)
  • C to T, chromosome 5 at 118,255,815 bp (GRCm38)
  • A to G, chromosome 5 at 125,387,447 bp (GRCm38)
  • A to T, chromosome 6 at 46,988,792 bp (GRCm38)
  • G to C, chromosome 6 at 91,017,393 bp (GRCm38)
  • G to A, chromosome 6 at 108,416,909 bp (GRCm38)
  • T to C, chromosome 7 at 4,508,502 bp (GRCm38)
  • A to G, chromosome 7 at 16,071,967 bp (GRCm38)
  • A to T, chromosome 7 at 41,043,687 bp (GRCm38)
  • T to A, chromosome 7 at 75,736,342 bp (GRCm38)
  • A to G, chromosome 7 at 80,334,037 bp (GRCm38)
  • A to G, chromosome 7 at 144,498,779 bp (GRCm38)
  • A to T, chromosome 8 at 33,324,273 bp (GRCm38)
  • T to C, chromosome 8 at 63,927,617 bp (GRCm38)
  • A to C, chromosome 8 at 105,178,611 bp (GRCm38)
  • A to G, chromosome 8 at 111,845,175 bp (GRCm38)
  • A to G, chromosome 8 at 119,508,882 bp (GRCm38)
  • A to T, chromosome 9 at 21,592,922 bp (GRCm38)
  • A to G, chromosome 9 at 37,406,213 bp (GRCm38)
  • ATCGTCCGGCTCGTCCTCGTCGTCGTCC to ATCGTCC, chromosome 9 at 59,486,237 bp (GRCm38)
  • A to G, chromosome 9 at 75,010,230 bp (GRCm38)
  • A to T, chromosome 9 at 78,479,350 bp (GRCm38)
  • T to A, chromosome 9 at 79,780,644 bp (GRCm38)
  • C to T, chromosome 10 at 5,323,887 bp (GRCm38)
  • C to A, chromosome 10 at 41,488,287 bp (GRCm38)
  • T to C, chromosome 10 at 107,542,662 bp (GRCm38)
  • G to T, chromosome 10 at 129,011,890 bp (GRCm38)
  • G to A, chromosome 11 at 22,973,418 bp (GRCm38)
  • T to C, chromosome 11 at 83,402,598 bp (GRCm38)
  • TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,100,036 bp (GRCm38)
  • A to T, chromosome 11 at 97,167,634 bp (GRCm38)
  • T to A, chromosome 11 at 106,285,433 bp (GRCm38)
  • T to C, chromosome 11 at 117,779,169 bp (GRCm38)
  • G to A, chromosome 11 at 118,333,940 bp (GRCm38)
  • C to A, chromosome 12 at 55,382,257 bp (GRCm38)
  • T to A, chromosome 12 at 85,892,122 bp (GRCm38)
  • T to G, chromosome 13 at 15,726,668 bp (GRCm38)
  • A to G, chromosome 13 at 54,718,537 bp (GRCm38)
  • A to G, chromosome 13 at 93,621,571 bp (GRCm38)
  • G to A, chromosome 14 at 7,926,421 bp (GRCm38)
  • A to G, chromosome 14 at 12,237,809 bp (GRCm38)
  • T to A, chromosome 14 at 20,722,163 bp (GRCm38)
  • C to A, chromosome 14 at 31,294,815 bp (GRCm38)
  • T to C, chromosome 14 at 70,477,866 bp (GRCm38)
  • A to T, chromosome 15 at 47,849,720 bp (GRCm38)
  • T to C, chromosome 16 at 59,506,250 bp (GRCm38)
  • T to C, chromosome 17 at 20,815,053 bp (GRCm38)
  • T to C, chromosome 17 at 25,167,381 bp (GRCm38)
  • T to A, chromosome 17 at 27,886,779 bp (GRCm38)
  • T to A, chromosome 17 at 35,621,828 bp (GRCm38)
  • C to T, chromosome 17 at 49,473,304 bp (GRCm38)
  • A to T, chromosome 19 at 7,274,226 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9621 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069414-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.