Strain Name:
C57BL/6J-MtgxR9621Btlr/Mmmh
Stock Number:
069414-MU
Citation ID:
RRID:MMRRC_069414-MU
Other Names:
R9621 (G1)
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Ubc
Name: ubiquitin C
Synonyms: 2700054O04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22190
Homologene: 128418
Cfdp1
Name: craniofacial development protein 1
Synonyms: cp27, Bucentaur, Bcnt
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23837
HGNC: HGNC:1873
Homologene: 4611
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Pmpca
Name: peptidase (mitochondrial processing) alpha
Synonyms: INPP5E, Alpha-MPP, 4933435E07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66865
Homologene: 6078
Ift70b
Name: intraflagellar transport 70B
Synonyms: 2510042P03Rik, Ttc30b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72421
Homologene: 71716
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Kpnb1
Name: karyopherin subunit beta 1
Synonyms: Impnb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16211
HGNC: HGNC:6400
Homologene: 1707
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: mTAFII140, 4933439M23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Flnb
Name: filamin, beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 286940
HGNC: HGNC:3755
Homologene: 37480
Arih1
Name: ariadne RBR E3 ubiquitin protein ligase 1
Synonyms: UIP77
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23806
HGNC: HGNC:689
Homologene: 111871
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Bltp3a
Name: bridge-like lipid transfer protein family member 3A
Synonyms: 1110020K19Rik, F830021D11Rik, Uhrf1bp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224648
Homologene: 9816
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Pcp-1, Itpr-1, Ip3r, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Abca1
Name: ATP-binding cassette, sub-family A member 1
Synonyms: ABC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11303
HGNC: HGNC:29
Homologene: 21130
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Adnp
Name: activity-dependent neuroprotective protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11538
Homologene: 7617
Cbfb
Name: core binding factor beta
Synonyms: Pebp2, PEA2, Pebpb2, PEBP2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12400
HGNC: HGNC:1539
Homologene: 11173
Ddx18
Name: DEAD box helicase 18
Synonyms: 2310005B10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66942
HGNC: HGNC:2741
Homologene: 6697
Prkcq
Name: protein kinase C, theta
Synonyms: PKC-0, Pkcq, A130035A12Rik, PKC-theta, PKC theta, PKCtheta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18761
HGNC: HGNC:9410
Homologene: 21263
Unc45a
Name: unc-45 myosin chaperone A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101869
Homologene: 32423
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241520
Homologene: 18462
Syt13
Name: synaptotagmin XIII
Synonyms: 5730409J20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80976
Homologene: 10823
Bmp1
Name: bone morphogenetic protein 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12153
VEGA: 14
HGNC: HGNC:1067
Homologene: 55955
Ppfia1
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Synonyms: liprin, C030014K08Rik, Liprin-alpha1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233977
HGNC: HGNC:9245
Homologene: 20802
Eef1a1
Name: eukaryotic translation elongation factor 1 alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13627
HGNC: HGNC:3189
Homologene: 100799
Sf3b4
Name: splicing factor 3b, subunit 4
Synonyms: SF3b49, Sap49, 49kDa
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 107701
Homologene: 134086
Amtn
Name: amelotin
Synonyms: 5430427O21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71421
Homologene: 52640
Cntrl
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Ino80
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68142
Homologene: 75070
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Tnnt1
Name: troponin T1, skeletal, slow
Synonyms: Tnt, skeletal muscle slow-twitch TnT, sTnT, ssTnT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21955
Homologene: 20704
Spring1
Name: SREBF pathway regulator in golgi 1
Synonyms: 2410131K14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76792
Homologene: 32599
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Ttll5
Name: tubulin tyrosine ligase-like family, member 5
Synonyms: 4930556H18Rik, 2310009M18Rik, 1700048H13Rik, D630041K24Rik, STAMP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320244
Homologene: 9013
Man1a2
Name: mannosidase, alpha, class 1A, member 2
Synonyms: Man1b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17156
HGNC: HGNC:6822
Homologene: 55982
Bhmt
Name: betaine-homocysteine methyltransferase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12116
HGNC: HGNC:1047
Homologene: 1295
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Gm4884
Name: predicted gene 4884
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233164
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Rnf224
Name: ring finger protein 224
Synonyms: LOC329360, Gm757
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329360
Homologene: 121711
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: Marlin-1, 5830437M04Rik, C330021K24Rik, Gababrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Cdhr2
Name: cadherin-related family member 2
Synonyms: LOC268663, Pcdh24
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
Atosa
Name: atos homolog A
Synonyms: 6330415I01Rik, C130047D21Rik, BC031353, Fam214a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235493
VEGA: 9
Homologene: 35065
Timm29
Name: translocase of inner mitochondrial membrane 29
Synonyms: 1810026J23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69773
Homologene: 34702
Tmem30a
Name: transmembrane protein 30A
Synonyms: 2010200I23Rik, D9Wsu20e, Cdc50a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69981
Homologene: 110703
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666528
Homologene: 12991
Prorp
Name: protein only RNase P catalytic subunit
Synonyms: Mrpp3, 1110008L16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66132
Homologene: 45935
Gabrb1
Name: gamma-aminobutyric acid type A receptor subunit beta 1
Synonyms: Gabrb-1, B230208N19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14400
HGNC: HGNC:4081
Homologene: 20221
Gli3
Name: GLI-Kruppel family member GLI3
Synonyms: Bph, brachyphalangy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14634
HGNC: HGNC:4319
Homologene: 139
Zswim8
Name: zinc finger SWIM-type containing 8
Synonyms: 4832404P21Rik, 2310021P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268721
VEGA: 14
Homologene: 34313
Tmc6
Name: transmembrane channel-like gene family 6
Synonyms: EVER1, D11Ertd204e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217353
Homologene: 5258
Daam2
Name: dishevelled associated activator of morphogenesis 2
Synonyms: 2310016D11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76441
VEGA: 17
Homologene: 69186
Or10p21
Name: olfactory receptor family 10 subfamily P member 21
Synonyms: GA_x6K02T2PULF-10696986-10697915, MOR269-2, Olfr763
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258861
Homologene: 85121
Tcam1
Name: testicular cell adhesion molecule 1
Synonyms: 4930570F09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75870
Homologene: 123944
Cdh26
Name: cadherin-like 26
Synonyms: LOC381409
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381409
Homologene: 18643
Ccdc154
Name: coiled-coil domain containing 154
Synonyms: LOC207209, ntl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207209
Homologene: 19361
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: 2410154J16Rik, Ndp52l1, Ndp52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Vmn1r229
Name: vomeronasal 1 receptor 229
Synonyms: V1re1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171224
Homologene: 74319
Tekt2
Name: tektin 2
Synonyms: tektin-t
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24084
Homologene: 8043
Alg6
Name: ALG6 alpha-1,3-glucosyltransferase
Synonyms: E230028F23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320438
Homologene: 6920
Smpd2
Name: sphingomyelin phosphodiesterase 2, neutral
Synonyms: nSMase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20598
Homologene: 31129
Rcor2
Name: REST corepressor 2
Synonyms: CoREST, 1A13
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104383
Homologene: 14280
Zrsr2-ps1
Name: zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2, pseudogene 1
Synonyms: U2afbp-rs, Irlgs2, D11Ncvs75, 35kDa, SP2, U2af1-rs1, Zrsr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22183
Homologene: 84793
Cep295nl
Name: CEP295 N-terminal like
Synonyms: Ddc8, BC100451
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58251
Homologene: 75164
Qsox1
Name: quiescin Q6 sulfhydryl oxidase 1
Synonyms: 1300003H02Rik, Qscn6, QSOX, b2b2673Clo
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 104009
HGNC: HGNC:9756
Homologene: 37690
Dio1
Name: deiodinase, iodothyronine, type I
Synonyms: D1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13370
HGNC: HGNC:2883
Homologene: 620
Sgo2b
Name: shugoshin 2B
Synonyms: Gm4975, Sgol2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244495
Homologene: 51867
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp (GRCm38)
  • A to G, chromosome 1 at 63,303,476 bp (GRCm38)
  • G to A, chromosome 1 at 93,055,723 bp (GRCm38)
  • T to C, chromosome 1 at 121,561,403 bp (GRCm38)
  • T to C, chromosome 1 at 133,071,607 bp (GRCm38)
  • TG to T, chromosome 1 at 155,795,389 bp (GRCm38)
  • A to T, chromosome 2 at 9,918,259 bp (GRCm38)
  • A to T, chromosome 2 at 11,256,203 bp (GRCm38)
  • A to T, chromosome 2 at 25,236,188 bp (GRCm38)
  • A to G, chromosome 2 at 26,389,976 bp (GRCm38)
  • A to G, chromosome 2 at 35,160,266 bp (GRCm38)
  • T to C, chromosome 2 at 75,937,800 bp (GRCm38)
  • T to C, chromosome 2 at 76,918,097 bp (GRCm38)
  • G to A, chromosome 2 at 83,812,765 bp (GRCm38)
  • G to A, chromosome 2 at 92,915,230 bp (GRCm38)
  • C to G, chromosome 2 at 119,450,015 bp (GRCm38)
  • A to T, chromosome 2 at 168,182,743 bp (GRCm38)
  • T to A, chromosome 2 at 178,470,190 bp (GRCm38)
  • T to A, chromosome 3 at 96,176,799 bp (GRCm38)
  • A to G, chromosome 3 at 100,684,645 bp (GRCm38)
  • A to T, chromosome 3 at 133,488,006 bp (GRCm38)
  • T to C, chromosome 4 at 53,092,918 bp (GRCm38)
  • T to A, chromosome 4 at 99,726,894 bp (GRCm38)
  • C to T, chromosome 4 at 107,292,361 bp (GRCm38)
  • C to T, chromosome 4 at 126,323,651 bp (GRCm38)
  • A to T, chromosome 5 at 37,117,468 bp (GRCm38)
  • G to A, chromosome 5 at 72,122,020 bp (GRCm38)
  • C to A, chromosome 5 at 88,380,346 bp (GRCm38)
  • C to T, chromosome 5 at 118,255,815 bp (GRCm38)
  • A to G, chromosome 5 at 125,387,447 bp (GRCm38)
  • A to T, chromosome 6 at 46,988,792 bp (GRCm38)
  • G to C, chromosome 6 at 91,017,393 bp (GRCm38)
  • G to A, chromosome 6 at 108,416,909 bp (GRCm38)
  • T to C, chromosome 7 at 4,508,502 bp (GRCm38)
  • A to G, chromosome 7 at 16,071,967 bp (GRCm38)
  • A to T, chromosome 7 at 41,043,687 bp (GRCm38)
  • T to A, chromosome 7 at 75,736,342 bp (GRCm38)
  • A to G, chromosome 7 at 80,334,037 bp (GRCm38)
  • A to G, chromosome 7 at 144,498,779 bp (GRCm38)
  • A to T, chromosome 8 at 33,324,273 bp (GRCm38)
  • T to C, chromosome 8 at 63,927,617 bp (GRCm38)
  • A to C, chromosome 8 at 105,178,611 bp (GRCm38)
  • A to G, chromosome 8 at 111,845,175 bp (GRCm38)
  • A to G, chromosome 8 at 119,508,882 bp (GRCm38)
  • A to T, chromosome 9 at 21,592,922 bp (GRCm38)
  • A to G, chromosome 9 at 37,406,213 bp (GRCm38)
  • ATCGTCCGGCTCGTCCTCGTCGTCGTCC to ATCGTCC, chromosome 9 at 59,486,237 bp (GRCm38)
  • A to G, chromosome 9 at 75,010,230 bp (GRCm38)
  • A to T, chromosome 9 at 78,479,350 bp (GRCm38)
  • T to A, chromosome 9 at 79,780,644 bp (GRCm38)
  • C to T, chromosome 10 at 5,323,887 bp (GRCm38)
  • C to A, chromosome 10 at 41,488,287 bp (GRCm38)
  • T to C, chromosome 10 at 107,542,662 bp (GRCm38)
  • G to T, chromosome 10 at 129,011,890 bp (GRCm38)
  • G to A, chromosome 11 at 22,973,418 bp (GRCm38)
  • T to C, chromosome 11 at 83,402,598 bp (GRCm38)
  • TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,100,036 bp (GRCm38)
  • A to T, chromosome 11 at 97,167,634 bp (GRCm38)
  • T to A, chromosome 11 at 106,285,433 bp (GRCm38)
  • T to C, chromosome 11 at 117,779,169 bp (GRCm38)
  • G to A, chromosome 11 at 118,333,940 bp (GRCm38)
  • C to A, chromosome 12 at 55,382,257 bp (GRCm38)
  • T to A, chromosome 12 at 85,892,122 bp (GRCm38)
  • T to G, chromosome 13 at 15,726,668 bp (GRCm38)
  • A to G, chromosome 13 at 54,718,537 bp (GRCm38)
  • A to G, chromosome 13 at 93,621,571 bp (GRCm38)
  • G to A, chromosome 14 at 7,926,421 bp (GRCm38)
  • A to G, chromosome 14 at 12,237,809 bp (GRCm38)
  • T to A, chromosome 14 at 20,722,163 bp (GRCm38)
  • C to A, chromosome 14 at 31,294,815 bp (GRCm38)
  • T to C, chromosome 14 at 70,477,866 bp (GRCm38)
  • A to T, chromosome 15 at 47,849,720 bp (GRCm38)
  • T to C, chromosome 16 at 59,506,250 bp (GRCm38)
  • T to C, chromosome 17 at 20,815,053 bp (GRCm38)
  • T to C, chromosome 17 at 25,167,381 bp (GRCm38)
  • T to A, chromosome 17 at 27,886,779 bp (GRCm38)
  • T to A, chromosome 17 at 35,621,828 bp (GRCm38)
  • C to T, chromosome 17 at 49,473,304 bp (GRCm38)
  • A to T, chromosome 19 at 7,274,226 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9621 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069414-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.