Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9624Btlr/Mmmh
Stock Number:
069417-MU
Citation ID:
RRID:MMRRC_069417-MU
Other Names:
R9624 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Foxj3
Name: forkhead box J3
Synonyms: C330039G02Rik, Fhd6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230700
Homologene: 35243
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 6030449K19Rik, 2900036C23Rik, 2410152H17Rik, 2810413I22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Wapl
Name: WAPL cohesin release factor
Synonyms: A530089A20Rik, Wapal
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218914
Homologene: 41002
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Fanci
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 208836
Homologene: 49530
Rad17
Name: RAD17 checkpoint clamp loader component
Synonyms: MmRad24, 9430035O09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19356
VEGA: 13
HGNC: HGNC:9807
Homologene: 32117
Gps1
Name: G protein pathway suppressor 1
Synonyms: COPS1, Csn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209318
HGNC: HGNC:4549
Homologene: 3046
Ankrd27
Name: ankyrin repeat domain 27
Synonyms: D330003H11Rik, Varp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245886
Homologene: 12956
Ikzf1
Name: IKAROS family zinc finger 1
Synonyms: LyF-1, Ikaros, 5832432G11Rik, Zfpn1a1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22778
Homologene: 55948
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Atp1b3
Name: ATPase, Na+/K+ transporting, beta 3 polypeptide
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11933
HGNC: HGNC:806
Homologene: 37510
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, 2810425C21Rik, D13Ucla1, DAP-Kinase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Cxxc1
Name: CXXC finger protein 1
Synonyms: 5830420C16Rik, 2410002I16Rik, PHF18, Cgbp, Cfp1, CXXC finger 1 (PHD domain)
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74322
VEGA: 18
Homologene: 32221
Spindoc
Name: spindlin interactor and repressor of chromatin binding
Synonyms: AI846148
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68229
VEGA: 19
Homologene: 19195
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Tent4a
Name: terminal nucleotidyltransferase 4A
Synonyms: LAK-1, TRF4, TRF4-1, Pols, Papd7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210106
Homologene: 5089
Vmn1r78
Name: vomeronasal 1 receptor 78
Synonyms: V1rg7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171242
Homologene: 74316
Anapc15-ps
Name: anaphase promoting complex C subunit 15, pseudogene
Synonyms: Gm6843
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628119
VEGA: 10
Eln
Name: elastin
Synonyms: tropoelastin, E030024M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13717
HGNC: HGNC:3327
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Sorbs2
Name: sorbin and SH3 domain containing 2
Synonyms: 9430041O17Rik, 2010203O03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234214
Homologene: 83295
Vmn1r194
Name: vomeronasal 1 receptor 194
Synonyms: Gm11294
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 626299
Homologene: 110880
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Lratd2
Name: LRAT domain containing 1
Synonyms: D330050I23Rik, Fam84b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 399603
Homologene: 18379
Or8g30
Name: olfactory receptor family 8 subfamily G member 30
Synonyms: GA_x6K02T2PVTD-33016899-33015934, MOR171-45, MOR171-51, Olfr948
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257912
VEGA: 9
HGNC: HGNC:8484
Homologene: 79377
Or8g23
Name: olfactory receptor family 8 subfamily G member 23
Synonyms: GA_x6K02T2PVTD-32756567-32755632, MOR171-24, Olfr937
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258431
VEGA: 9
Homologene: 27167
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Ankfn1
Name: ankyrin-repeat and fibronectin type III domain containing 1
Synonyms: LOC382543, 4932411E22Rik, nmf9, mWAKE
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 382543
Homologene: 34996
Cpap
Name: centrosome assembly and centriole elongation protein
Synonyms: 4932437H03Rik, Cenpj, Sas4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219103
Homologene: 10204
Or10d1b
Name: olfactory receptor family 10 subfamily D member 1B
Synonyms: M31, MOR224-8, GA_x6K02T2PVTD-33400306-33399371, Olfr149
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235256
VEGA: 9
Homologene: 28452
Or10j3
Name: olfactory receptor family 10 subfamily J member 3B
Synonyms: GA_x6K02SYWG4P-534-1100, GA_x6K02T2R7CC-643715-642847, MOR267-3, MOR267-3, Olfr1405-ps1, Olfr218
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258880
Homologene: 105155
Spata13
Name: spermatogenesis associated 13
Synonyms: ESTM11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219140
Homologene: 19482
Atxn7l3
Name: ataxin 7-like 3
Synonyms: E030022H21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217218
Homologene: 35401
Fam83g
Name: family with sequence similarity 83, member G
Synonyms: 2310040C09Rik, wly
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69640
Homologene: 85169
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Or6c33
Name: olfactory receptor family 6 subfamily C member 33
Synonyms: GA_x6K02T2PULF-11688441-11689379, MOR116-1, Olfr820
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258670
Homologene: 17337
B430305J03Rik
Name: RIKEN cDNA B430305J03 gene
Type: Gene
Species: Mouse
Chromosome: 3
Or2y1
Name: olfactory receptor family 2 subfamily Y member 1
Synonyms: GA_x6K02T2QP88-5941817-5940888, MOR256-42P, MOR256-42P, MOR256-41P, Olfr1549-ps1, Olfr1385
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258027
Homologene: 86692
Vmn1r43
Name: vomeronasal 1 receptor 43
Synonyms: V1ra5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113847
Homologene: 130651
Prss33
Name: serine protease 33
Synonyms: tryptase-6, mT6, Eos
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 353130
Homologene: 77185
Slc38a3
Name: solute carrier family 38, member 3
Synonyms: 0610012J02Rik, D9Ucla2, Snat3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76257
Homologene: 4983
Fam47e
Name: family with sequence similarity 47, member E
Synonyms: LOC384198, Gm1381
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384198
Homologene: 129958
Hs3st3b1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms: 3OST3B1, HS3ST3B1, 3-OST-3B, m3-OST-3B, 3Ost3b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54710
HGNC: HGNC:5198
Homologene: 88576
Prl7a2
Name: prolactin family 7, subfamily a, member 2
Synonyms: PLP-F, Prlpf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19114
Homologene: 49263
Cacnb4
Name: calcium channel, voltage-dependent, beta 4 subunit
Synonyms: Cchb4, 3110038O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12298
HGNC: HGNC:1404
Homologene: 20188
Sppl2b
Name: signal peptide peptidase like 2B
Synonyms: 3110056O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73218
VEGA: 10
Homologene: 10605
Tmem128
Name: transmembrane protein 128
Synonyms: 2810021O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66309
Homologene: 11944
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 173,204,105 bp (GRCm38)
  • T to C, chromosome 2 at 52,474,930 bp (GRCm38)
  • A to T, chromosome 2 at 66,323,422 bp (GRCm38)
  • A to T, chromosome 2 at 127,804,846 bp (GRCm38)
  • T to A, chromosome 2 at 175,170,336 bp (GRCm38)
  • G to T, chromosome 3 at 58,629,345 bp (GRCm38)
  • C to A, chromosome 3 at 61,363,987 bp (GRCm38)
  • T to A, chromosome 4 at 119,626,392 bp (GRCm38)
  • G to T, chromosome 4 at 136,931,754 bp (GRCm38)
  • G to T, chromosome 5 at 38,264,892 bp (GRCm38)
  • G to C, chromosome 5 at 92,578,536 bp (GRCm38)
  • A to G, chromosome 5 at 134,710,137 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • G to A, chromosome 7 at 12,152,483 bp (GRCm38)
  • A to T, chromosome 7 at 35,602,466 bp (GRCm38)
  • A to T, chromosome 7 at 79,435,369 bp (GRCm38)
  • A to T, chromosome 7 at 110,364,650 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GGGACCAGCTCAGCCACG to GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG, chromosome 7 at 126,467,572 bp (GRCm38)
  • AGCTCAGCCACGGGGAC to AGCTCAGCCACGGGGACACGCTCAGCCACGGGGAC, chromosome 7 at 126,467,578 bp (GRCm38)
  • A to G, chromosome 7 at 138,394,194 bp (GRCm38)
  • A to G, chromosome 8 at 45,775,653 bp (GRCm38)
  • T to A, chromosome 9 at 39,060,157 bp (GRCm38)
  • G to T, chromosome 9 at 39,319,552 bp (GRCm38)
  • A to G, chromosome 9 at 39,702,526 bp (GRCm38)
  • A to G, chromosome 9 at 70,395,874 bp (GRCm38)
  • A to G, chromosome 9 at 96,340,240 bp (GRCm38)
  • A to G, chromosome 9 at 107,655,311 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • T to A, chromosome 10 at 80,863,539 bp (GRCm38)
  • T to C, chromosome 10 at 95,673,103 bp (GRCm38)
  • T to C, chromosome 10 at 130,017,997 bp (GRCm38)
  • G to A, chromosome 11 at 8,451,142 bp (GRCm38)
  • A to G, chromosome 11 at 11,769,219 bp (GRCm38)
  • T to A, chromosome 11 at 49,495,007 bp (GRCm38)
  • C to T, chromosome 11 at 61,684,502 bp (GRCm38)
  • T to C, chromosome 11 at 63,889,284 bp (GRCm38)
  • T to C, chromosome 11 at 89,523,207 bp (GRCm38)
  • T to C, chromosome 11 at 102,292,026 bp (GRCm38)
  • C to A, chromosome 11 at 120,786,608 bp (GRCm38)
  • A to G, chromosome 12 at 72,450,812 bp (GRCm38)
  • A to T, chromosome 12 at 113,545,450 bp (GRCm38)
  • T to A, chromosome 13 at 22,244,501 bp (GRCm38)
  • T to A, chromosome 13 at 27,665,886 bp (GRCm38)
  • T to C, chromosome 13 at 60,748,123 bp (GRCm38)
  • A to T, chromosome 13 at 69,503,668 bp (GRCm38)
  • T to C, chromosome 13 at 100,636,995 bp (GRCm38)
  • C to T, chromosome 14 at 31,141,388 bp (GRCm38)
  • T to A, chromosome 14 at 34,692,106 bp (GRCm38)
  • T to C, chromosome 14 at 43,578,035 bp (GRCm38)
  • A to T, chromosome 14 at 56,564,930 bp (GRCm38)
  • C to T, chromosome 14 at 60,706,900 bp (GRCm38)
  • A to T, chromosome 15 at 60,823,144 bp (GRCm38)
  • C to A, chromosome 16 at 34,879,307 bp (GRCm38)
  • A to T, chromosome 16 at 56,169,712 bp (GRCm38)
  • A to G, chromosome 17 at 23,835,682 bp (GRCm38)
  • T to A, chromosome 17 at 57,220,189 bp (GRCm38)
  • G to A, chromosome 18 at 63,064,696 bp (GRCm38)
  • A to T, chromosome 18 at 74,219,441 bp (GRCm38)
  • G to A, chromosome 19 at 7,374,832 bp (GRCm38)
  • T to A, chromosome 19 at 9,012,482 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9624 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069417-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.