Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9624Btlr/Mmmh
Stock Number:
069417-MU
Citation ID:
RRID:MMRRC_069417-MU
Other Names:
R9624 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Foxj3
Name: forkhead box J3
Synonyms: C330039G02Rik, Fhd6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230700
Homologene: 35243
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 6030449K19Rik, 2900036C23Rik, 2410152H17Rik, 2810413I22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Wapl
Name: WAPL cohesin release factor
Synonyms: A530089A20Rik, Wapal
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218914
Homologene: 41002
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 173,204,105 bp (GRCm38)
  • T to C, chromosome 2 at 52,474,930 bp (GRCm38)
  • A to T, chromosome 2 at 66,323,422 bp (GRCm38)
  • A to T, chromosome 2 at 127,804,846 bp (GRCm38)
  • T to A, chromosome 2 at 175,170,336 bp (GRCm38)
  • G to T, chromosome 3 at 58,629,345 bp (GRCm38)
  • C to A, chromosome 3 at 61,363,987 bp (GRCm38)
  • T to A, chromosome 4 at 119,626,392 bp (GRCm38)
  • G to T, chromosome 4 at 136,931,754 bp (GRCm38)
  • G to T, chromosome 5 at 38,264,892 bp (GRCm38)
  • G to C, chromosome 5 at 92,578,536 bp (GRCm38)
  • A to G, chromosome 5 at 134,710,137 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • G to A, chromosome 7 at 12,152,483 bp (GRCm38)
  • A to T, chromosome 7 at 35,602,466 bp (GRCm38)
  • A to T, chromosome 7 at 79,435,369 bp (GRCm38)
  • A to T, chromosome 7 at 110,364,650 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GGGACCAGCTCAGCCACG to GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG, chromosome 7 at 126,467,572 bp (GRCm38)
  • AGCTCAGCCACGGGGAC to AGCTCAGCCACGGGGACACGCTCAGCCACGGGGAC, chromosome 7 at 126,467,578 bp (GRCm38)
  • A to G, chromosome 7 at 138,394,194 bp (GRCm38)
  • A to G, chromosome 8 at 45,775,653 bp (GRCm38)
  • T to A, chromosome 9 at 39,060,157 bp (GRCm38)
  • G to T, chromosome 9 at 39,319,552 bp (GRCm38)
  • A to G, chromosome 9 at 39,702,526 bp (GRCm38)
  • A to G, chromosome 9 at 70,395,874 bp (GRCm38)
  • A to G, chromosome 9 at 96,340,240 bp (GRCm38)
  • A to G, chromosome 9 at 107,655,311 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • T to A, chromosome 10 at 80,863,539 bp (GRCm38)
  • T to C, chromosome 10 at 95,673,103 bp (GRCm38)
  • T to C, chromosome 10 at 130,017,997 bp (GRCm38)
  • G to A, chromosome 11 at 8,451,142 bp (GRCm38)
  • A to G, chromosome 11 at 11,769,219 bp (GRCm38)
  • T to A, chromosome 11 at 49,495,007 bp (GRCm38)
  • C to T, chromosome 11 at 61,684,502 bp (GRCm38)
  • T to C, chromosome 11 at 63,889,284 bp (GRCm38)
  • T to C, chromosome 11 at 89,523,207 bp (GRCm38)
  • T to C, chromosome 11 at 102,292,026 bp (GRCm38)
  • C to A, chromosome 11 at 120,786,608 bp (GRCm38)
  • A to G, chromosome 12 at 72,450,812 bp (GRCm38)
  • A to T, chromosome 12 at 113,545,450 bp (GRCm38)
  • T to A, chromosome 13 at 22,244,501 bp (GRCm38)
  • T to A, chromosome 13 at 27,665,886 bp (GRCm38)
  • T to C, chromosome 13 at 60,748,123 bp (GRCm38)
  • A to T, chromosome 13 at 69,503,668 bp (GRCm38)
  • T to C, chromosome 13 at 100,636,995 bp (GRCm38)
  • C to T, chromosome 14 at 31,141,388 bp (GRCm38)
  • T to A, chromosome 14 at 34,692,106 bp (GRCm38)
  • T to C, chromosome 14 at 43,578,035 bp (GRCm38)
  • A to T, chromosome 14 at 56,564,930 bp (GRCm38)
  • C to T, chromosome 14 at 60,706,900 bp (GRCm38)
  • A to T, chromosome 15 at 60,823,144 bp (GRCm38)
  • C to A, chromosome 16 at 34,879,307 bp (GRCm38)
  • A to T, chromosome 16 at 56,169,712 bp (GRCm38)
  • A to G, chromosome 17 at 23,835,682 bp (GRCm38)
  • T to A, chromosome 17 at 57,220,189 bp (GRCm38)
  • G to A, chromosome 18 at 63,064,696 bp (GRCm38)
  • A to T, chromosome 18 at 74,219,441 bp (GRCm38)
  • G to A, chromosome 19 at 7,374,832 bp (GRCm38)
  • T to A, chromosome 19 at 9,012,482 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9624 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069417-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.