Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9644Btlr/Mmmh
Stock Number:
069437-MU
Citation ID:
RRID:MMRRC_069437-MU
Other Names:
R9644 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Emx2
Name: empty spiracles homeobox 2
Synonyms: Pdo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13797
HGNC: HGNC:3341
Homologene: 3023
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Acot7
Name: acyl-CoA thioesterase 7
Synonyms: 2410041A17Rik, Bach, AU014716
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70025
Homologene: 15780
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Kdm2b
Name: lysine (K)-specific demethylase 2B
Synonyms: Cxxc2, Jhdm1b, Fbxl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 30841
Homologene: 13069
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Kif18a
Name: kinesin family member 18A
Synonyms: N-8 kinesin, B130001M12Rik, gcd2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228421
Homologene: 41820
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Nemf
Name: nuclear export mediator factor
Synonyms: 4933405E14Rik, 1500011I12Rik, Sdccag1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66244
VEGA: 12
Homologene: 3458
Ccser2
Name: coiled-coil serine rich 2
Synonyms: 1700012P13Rik, 2900054P12Rik, Gcap14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72972
Homologene: 10367
Epm2aip1
Name: EPM2A interacting protein 1
Synonyms: A930003G21Rik, EPM2A (laforin) interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77781
Homologene: 8875
Foxi2
Name: forkhead box I2
Synonyms: B130055A05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 270004
Homologene: 18838
Pfas
Name: phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms: 4432409B16Rik, Sofa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237823
HGNC: HGNC:8863
Homologene: 5970
Gmeb1
Name: glucocorticoid modulatory element binding protein 1
Synonyms: 1110050A04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56809
HGNC: HGNC:4370
Homologene: 10647
Crim1
Name: cysteine rich transmembrane BMP regulator 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50766
VEGA: 17
HGNC: HGNC:2359
Homologene: 9510
Enpp3
Name: ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms: CD203c
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209558
VEGA: 10
HGNC: HGNC:3358
Homologene: 3683
Cct5
Name: chaperonin containing TCP1 subunit 5
Synonyms: Ccte, TCPE
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12465
HGNC: HGNC:1618
Homologene: 6287
Synrg
Name: synergin, gamma
Synonyms: L71-5, Ap1gbp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217030
HGNC: HGNC:557
Homologene: 105680
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Rasgef1b
Name: RasGEF domain family, member 1B
Synonyms: Gpig4, 4732452O09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320292
Homologene: 14860
Ccn4
Name: cellular communication network factor 4
Synonyms: Elm1, CCN4, Wisp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22402
Homologene: 2883
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Chn1
Name: chimerin 1
Synonyms: 1700112L09Rik, 0710001E19Rik, ARHGAP2, 2900046J01Rik, 0610007I19Rik, alpha2 chimaerin, alpha1 chimaerin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108699
HGNC: HGNC:1943
Homologene: 31056
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70417
Homologene: 23771
Gucy2g
Name: guanylate cyclase 2g
Synonyms: 2410077I05Rik, GC-G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73707
Homologene: 44544
Ube2u
Name: ubiquitin-conjugating enzyme E2U (putative)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381534
Homologene: 17594
Atp10b
Name: ATPase, class V, type 10B
Synonyms: 5930426O13Rik, 9030605H24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319767
Homologene: 70969
Ankrd48
Name: ankyrin repeat domain 48
Synonyms: 1700012M14Rik, GC3, 1700008J08Rik, Ankrd36
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76389
Homologene: 137366
Prdm8
Name: PR domain containing 8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77630
Homologene: 129760
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 252866
Homologene: 78104
Or1j14
Name: olfactory receptor family 1 subfamily J member 14
Synonyms: GA_x6K02T2NLDC-33222024-33222962, MOR136-4, Olfr342
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258950
Homologene: 74223
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Clec2e
Name: C-type lectin domain family 2, member e
Synonyms: Clra
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232409
Homologene: 131164
Thap12
Name: THAP domain containing 12
Synonyms: 2900052B10Rik, Dap4, Prkrir
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72981
HGNC: HGNC:9440
Homologene: 37952
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Tspyl1
Name: testis-specific protein, Y-encoded-like 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22110
Homologene: 22522
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Proz
Name: protein Z, vitamin K-dependent plasma glycoprotein
Synonyms: 1300015B06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66901
HGNC: HGNC:9460
Homologene: 2890
Phf2
Name: PHD finger protein 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18676
VEGA: 13
HGNC: HGNC:8920
Homologene: 3934
Arsk
Name: arylsulfatase K
Synonyms: 4833414G15Rik, 2810429K17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77041
Homologene: 12670
Dyrk1b
Name: dual-specificity tyrosine phosphorylation regulated kinase 1b
Synonyms: Mirk
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13549
HGNC: HGNC:3092
Homologene: 31253
Or5b123
Name: olfactory receptor family 5 subfamily B member 123
Synonyms: GA_x6K02T2RE5P-3951719-3952666, MOR202-18, Olfr1487
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258629
Homologene: 110492
Or10q3
Name: olfactory receptor family 10 subfamily Q member 3
Synonyms: GA_x6K02T2RE5P-2222521-2221490, MOR266-10, Olfr1419
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 257938
Homologene: 79473
Meox1
Name: mesenchyme homeobox 1
Synonyms: Mox-1, Mox1, D330041M02Rik, squig
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17285
HGNC: HGNC:7013
Homologene: 3326
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930438C08Rik, 4930589M24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
Trpc4
Name: transient receptor potential cation channel, subfamily C, member 4
Synonyms: CCE1, Trp4, STRPC4, Trrp4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22066
Homologene: 22955
Hace1
Name: HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms: A730034A22Rik, 1700042J16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209462
Homologene: 10807
Ctrc
Name: chymotrypsin C
Synonyms: 1810044E12Rik, caldecrin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76701
HGNC: HGNC:2523
Homologene: 21422
Apol8
Name: apolipoprotein L 8
Synonyms: 9830006J20Rik, Apol2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239552
VEGA: 15
Homologene: 12785
Dnali1
Name: dynein, axonemal, light intermediate polypeptide 1
Synonyms: 1700023A09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75563
Homologene: 2586
Prb1b
Name: proline-rich protein BstNI subfamily 1B
Synonyms: MP5, Prpmp5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381832
Gatad1
Name: GATA zinc finger domain containing 1
Synonyms: 2810047M21Rik, 2310031E19Rik, B330017N08Rik, 8430439A17Rik, Odag, 9130430G15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67210
Homologene: 56916
Vmn1r238
Name: vomeronasal 1 receptor, 238
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100312476
Homologene: 128342
Slc22a12
Name: solute carrier family 22 (organic anion/cation transporter), member 12
Synonyms: Rst, URAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20521
Homologene: 56442
Mcee
Name: methylmalonyl CoA epimerase
Synonyms: 1110007A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73724
Homologene: 13078
Or6c204
Name: olfactory receptor family 6 subfamily C member 204
Synonyms: GA_x6K02T2PULF-10872859-10871923, MOR114-15, Olfr773-ps1, Olfr773
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257664
Homologene: 123776
Atg101
Name: autophagy related 101
Synonyms: 9430023L20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68118
VEGA: 15
Homologene: 11072
Tor3a
Name: torsin family 3, member A
Synonyms: Adir
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30935
Homologene: 23359
Igkv4-86
Name: immunoglobulin kappa variable 4-86
Synonyms: LOC243451
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243451
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 6,859,052 bp (GRCm38)
  • T to A, chromosome 1 at 20,547,466 bp (GRCm38)
  • T to A, chromosome 1 at 58,228,119 bp (GRCm38)
  • T to A, chromosome 1 at 156,673,556 bp (GRCm38)
  • A to T, chromosome 2 at 36,527,765 bp (GRCm38)
  • A to T, chromosome 2 at 73,659,840 bp (GRCm38)
  • A to G, chromosome 2 at 109,341,172 bp (GRCm38)
  • C to T, chromosome 2 at 156,525,245 bp (GRCm38)
  • A to G, chromosome 3 at 54,222,278 bp (GRCm38)
  • T to C, chromosome 3 at 93,447,359 bp (GRCm38)
  • G to A, chromosome 3 at 133,487,303 bp (GRCm38)
  • T to A, chromosome 4 at 86,795,126 bp (GRCm38)
  • TAGAAGAAGAAGAAGAAGAAGAAGAAGA to TAGAAGAAGAAGAAGAAGAAGAAGA, chromosome 4 at 100,549,746 bp (GRCm38)
  • T to A, chromosome 4 at 125,056,609 bp (GRCm38)
  • T to C, chromosome 4 at 132,232,129 bp (GRCm38)
  • A to G, chromosome 4 at 141,845,025 bp (GRCm38)
  • A to G, chromosome 4 at 149,291,379 bp (GRCm38)
  • C to A, chromosome 4 at 152,186,295 bp (GRCm38)
  • A to G, chromosome 5 at 3,641,442 bp (GRCm38)
  • A to G, chromosome 5 at 81,724,189 bp (GRCm38)
  • A to T, chromosome 5 at 98,185,779 bp (GRCm38)
  • A to T, chromosome 5 at 99,232,155 bp (GRCm38)
  • A to T, chromosome 5 at 122,982,779 bp (GRCm38)
  • C to T, chromosome 6 at 68,910,609 bp (GRCm38)
  • C to T, chromosome 6 at 115,963,313 bp (GRCm38)
  • T to A, chromosome 6 at 129,093,480 bp (GRCm38)
  • T to A, chromosome 6 at 132,312,255 bp (GRCm38)
  • T to C, chromosome 7 at 28,182,365 bp (GRCm38)
  • G to T, chromosome 7 at 64,411,982 bp (GRCm38)
  • T to C, chromosome 7 at 98,715,288 bp (GRCm38)
  • T to C, chromosome 7 at 102,095,232 bp (GRCm38)
  • A to C, chromosome 7 at 135,411,998 bp (GRCm38)
  • T to A, chromosome 8 at 13,066,854 bp (GRCm38)
  • T to A, chromosome 8 at 43,651,729 bp (GRCm38)
  • C to T, chromosome 8 at 122,890,943 bp (GRCm38)
  • T to A, chromosome 9 at 72,906,211 bp (GRCm38)
  • G to A, chromosome 9 at 75,136,349 bp (GRCm38)
  • C to T, chromosome 9 at 111,273,069 bp (GRCm38)
  • C to T, chromosome 10 at 24,809,903 bp (GRCm38)
  • T to C, chromosome 10 at 34,283,139 bp (GRCm38)
  • T to C, chromosome 10 at 45,649,905 bp (GRCm38)
  • T to G, chromosome 10 at 53,697,246 bp (GRCm38)
  • A to G, chromosome 10 at 129,186,869 bp (GRCm38)
  • A to G, chromosome 11 at 5,643,835 bp (GRCm38)
  • C to T, chromosome 11 at 43,151,832 bp (GRCm38)
  • T to C, chromosome 11 at 68,992,716 bp (GRCm38)
  • A to G, chromosome 11 at 83,214,902 bp (GRCm38)
  • T to C, chromosome 11 at 84,019,870 bp (GRCm38)
  • T to A, chromosome 11 at 101,878,656 bp (GRCm38)
  • C to A, chromosome 11 at 107,672,861 bp (GRCm38)
  • A to G, chromosome 12 at 25,011,019 bp (GRCm38)
  • T to A, chromosome 12 at 69,312,662 bp (GRCm38)
  • G to T, chromosome 13 at 48,870,742 bp (GRCm38)
  • G to A, chromosome 13 at 76,072,108 bp (GRCm38)
  • A to T, chromosome 14 at 36,879,193 bp (GRCm38)
  • T to A, chromosome 14 at 61,205,979 bp (GRCm38)
  • T to A, chromosome 15 at 28,230,504 bp (GRCm38)
  • A to G, chromosome 15 at 31,601,699 bp (GRCm38)
  • T to G, chromosome 15 at 66,912,936 bp (GRCm38)
  • C to A, chromosome 15 at 77,749,495 bp (GRCm38)
  • A to T, chromosome 15 at 98,845,504 bp (GRCm38)
  • A to G, chromosome 15 at 101,290,566 bp (GRCm38)
  • T to A, chromosome 16 at 22,083,985 bp (GRCm38)
  • A to G, chromosome 17 at 46,955,780 bp (GRCm38)
  • G to A, chromosome 17 at 78,280,068 bp (GRCm38)
  • T to A, chromosome 18 at 3,122,635 bp (GRCm38)
  • A to T, chromosome 18 at 57,242,701 bp (GRCm38)
  • G to C, chromosome 19 at 6,537,643 bp (GRCm38)
  • T to C, chromosome 19 at 11,871,210 bp (GRCm38)
  • G to T, chromosome 19 at 13,619,980 bp (GRCm38)
  • C to G, chromosome 19 at 55,231,105 bp (GRCm38)
  • T to C, chromosome 19 at 59,463,995 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9644 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069437-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text