Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9644Btlr/Mmmh
Stock Number:
069437-MU
Citation ID:
RRID:MMRRC_069437-MU
Other Names:
R9644 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Emx2
Name: empty spiracles homeobox 2
Synonyms: Pdo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13797
HGNC: HGNC:3341
Homologene: 3023
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 6,859,052 bp (GRCm38)
  • T to A, chromosome 1 at 20,547,466 bp (GRCm38)
  • T to A, chromosome 1 at 58,228,119 bp (GRCm38)
  • T to A, chromosome 1 at 156,673,556 bp (GRCm38)
  • A to T, chromosome 2 at 36,527,765 bp (GRCm38)
  • A to T, chromosome 2 at 73,659,840 bp (GRCm38)
  • A to G, chromosome 2 at 109,341,172 bp (GRCm38)
  • C to T, chromosome 2 at 156,525,245 bp (GRCm38)
  • A to G, chromosome 3 at 54,222,278 bp (GRCm38)
  • T to C, chromosome 3 at 93,447,359 bp (GRCm38)
  • G to A, chromosome 3 at 133,487,303 bp (GRCm38)
  • T to A, chromosome 4 at 86,795,126 bp (GRCm38)
  • TAGAAGAAGAAGAAGAAGAAGAAGAAGA to TAGAAGAAGAAGAAGAAGAAGAAGA, chromosome 4 at 100,549,746 bp (GRCm38)
  • T to A, chromosome 4 at 125,056,609 bp (GRCm38)
  • T to C, chromosome 4 at 132,232,129 bp (GRCm38)
  • A to G, chromosome 4 at 141,845,025 bp (GRCm38)
  • A to G, chromosome 4 at 149,291,379 bp (GRCm38)
  • C to A, chromosome 4 at 152,186,295 bp (GRCm38)
  • A to G, chromosome 5 at 3,641,442 bp (GRCm38)
  • A to G, chromosome 5 at 81,724,189 bp (GRCm38)
  • A to T, chromosome 5 at 98,185,779 bp (GRCm38)
  • A to T, chromosome 5 at 99,232,155 bp (GRCm38)
  • A to T, chromosome 5 at 122,982,779 bp (GRCm38)
  • C to T, chromosome 6 at 68,910,609 bp (GRCm38)
  • C to T, chromosome 6 at 115,963,313 bp (GRCm38)
  • T to A, chromosome 6 at 129,093,480 bp (GRCm38)
  • T to A, chromosome 6 at 132,312,255 bp (GRCm38)
  • T to C, chromosome 7 at 28,182,365 bp (GRCm38)
  • G to T, chromosome 7 at 64,411,982 bp (GRCm38)
  • T to C, chromosome 7 at 98,715,288 bp (GRCm38)
  • T to C, chromosome 7 at 102,095,232 bp (GRCm38)
  • A to C, chromosome 7 at 135,411,998 bp (GRCm38)
  • T to A, chromosome 8 at 13,066,854 bp (GRCm38)
  • T to A, chromosome 8 at 43,651,729 bp (GRCm38)
  • C to T, chromosome 8 at 122,890,943 bp (GRCm38)
  • T to A, chromosome 9 at 72,906,211 bp (GRCm38)
  • G to A, chromosome 9 at 75,136,349 bp (GRCm38)
  • C to T, chromosome 9 at 111,273,069 bp (GRCm38)
  • C to T, chromosome 10 at 24,809,903 bp (GRCm38)
  • T to C, chromosome 10 at 34,283,139 bp (GRCm38)
  • T to C, chromosome 10 at 45,649,905 bp (GRCm38)
  • T to G, chromosome 10 at 53,697,246 bp (GRCm38)
  • A to G, chromosome 10 at 129,186,869 bp (GRCm38)
  • A to G, chromosome 11 at 5,643,835 bp (GRCm38)
  • C to T, chromosome 11 at 43,151,832 bp (GRCm38)
  • T to C, chromosome 11 at 68,992,716 bp (GRCm38)
  • A to G, chromosome 11 at 83,214,902 bp (GRCm38)
  • T to C, chromosome 11 at 84,019,870 bp (GRCm38)
  • T to A, chromosome 11 at 101,878,656 bp (GRCm38)
  • C to A, chromosome 11 at 107,672,861 bp (GRCm38)
  • A to G, chromosome 12 at 25,011,019 bp (GRCm38)
  • T to A, chromosome 12 at 69,312,662 bp (GRCm38)
  • G to T, chromosome 13 at 48,870,742 bp (GRCm38)
  • G to A, chromosome 13 at 76,072,108 bp (GRCm38)
  • A to T, chromosome 14 at 36,879,193 bp (GRCm38)
  • T to A, chromosome 14 at 61,205,979 bp (GRCm38)
  • T to A, chromosome 15 at 28,230,504 bp (GRCm38)
  • A to G, chromosome 15 at 31,601,699 bp (GRCm38)
  • T to G, chromosome 15 at 66,912,936 bp (GRCm38)
  • C to A, chromosome 15 at 77,749,495 bp (GRCm38)
  • A to T, chromosome 15 at 98,845,504 bp (GRCm38)
  • A to G, chromosome 15 at 101,290,566 bp (GRCm38)
  • T to A, chromosome 16 at 22,083,985 bp (GRCm38)
  • A to G, chromosome 17 at 46,955,780 bp (GRCm38)
  • G to A, chromosome 17 at 78,280,068 bp (GRCm38)
  • T to A, chromosome 18 at 3,122,635 bp (GRCm38)
  • A to T, chromosome 18 at 57,242,701 bp (GRCm38)
  • G to C, chromosome 19 at 6,537,643 bp (GRCm38)
  • T to C, chromosome 19 at 11,871,210 bp (GRCm38)
  • G to T, chromosome 19 at 13,619,980 bp (GRCm38)
  • C to G, chromosome 19 at 55,231,105 bp (GRCm38)
  • T to C, chromosome 19 at 59,463,995 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9644 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069437-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.