Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9648Btlr/Mmmh
Stock Number:
069441-MU
Citation ID:
RRID:MMRRC_069441-MU
Other Names:
R9648 (G1)
Major Collection:

Strain Information

Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Dnajc2
Name: DnaJ heat shock protein family (Hsp40) member C2
Synonyms: MIDA1, Mida1, Zrf1, Zrf2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22791
Homologene: 31656
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: LKB1IP, LIP1, 1200014D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71728
Homologene: 12406
Wdr43
Name: WD repeat domain 43
Synonyms: 2610318G08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72515
VEGA: 17
Homologene: 38810
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 52,126,536 bp (GRCm38)
  • A to T, chromosome 1 at 53,275,125 bp (GRCm38)
  • A to G, chromosome 1 at 75,528,941 bp (GRCm38)
  • T to A, chromosome 2 at 25,425,324 bp (GRCm38)
  • T to A, chromosome 2 at 32,340,443 bp (GRCm38)
  • T to A, chromosome 2 at 65,358,140 bp (GRCm38)
  • A to G, chromosome 2 at 67,516,255 bp (GRCm38)
  • T to A, chromosome 2 at 76,789,462 bp (GRCm38)
  • T to A, chromosome 2 at 148,045,879 bp (GRCm38)
  • T to C, chromosome 2 at 172,249,719 bp (GRCm38)
  • C to A, chromosome 2 at 180,660,675 bp (GRCm38)
  • A to G, chromosome 3 at 19,256,802 bp (GRCm38)
  • T to A, chromosome 3 at 28,120,751 bp (GRCm38)
  • A to T, chromosome 3 at 63,301,005 bp (GRCm38)
  • A to T, chromosome 3 at 83,838,533 bp (GRCm38)
  • A to C, chromosome 4 at 19,098,142 bp (GRCm38)
  • C to T, chromosome 4 at 88,676,823 bp (GRCm38)
  • G to A, chromosome 5 at 21,763,480 bp (GRCm38)
  • C to G, chromosome 5 at 38,672,897 bp (GRCm38)
  • A to G, chromosome 5 at 123,739,625 bp (GRCm38)
  • T to A, chromosome 5 at 134,255,916 bp (GRCm38)
  • T to A, chromosome 5 at 135,366,621 bp (GRCm38)
  • A to C, chromosome 5 at 137,407,730 bp (GRCm38)
  • C to T, chromosome 5 at 143,225,093 bp (GRCm38)
  • T to A, chromosome 6 at 35,225,811 bp (GRCm38)
  • T to C, chromosome 6 at 67,356,603 bp (GRCm38)
  • C to T, chromosome 6 at 113,803,746 bp (GRCm38)
  • C to A, chromosome 6 at 121,358,702 bp (GRCm38)
  • T to C, chromosome 6 at 128,609,853 bp (GRCm38)
  • T to C, chromosome 6 at 141,656,929 bp (GRCm38)
  • T to A, chromosome 6 at 142,771,209 bp (GRCm38)
  • G to A, chromosome 7 at 7,182,172 bp (GRCm38)
  • A to G, chromosome 7 at 92,658,110 bp (GRCm38)
  • A to G, chromosome 8 at 13,223,245 bp (GRCm38)
  • G to A, chromosome 8 at 27,119,144 bp (GRCm38)
  • T to C, chromosome 9 at 15,323,607 bp (GRCm38)
  • T to A, chromosome 9 at 18,857,452 bp (GRCm38)
  • T to C, chromosome 9 at 21,026,401 bp (GRCm38)
  • T to A, chromosome 9 at 21,941,083 bp (GRCm38)
  • A to T, chromosome 9 at 40,333,497 bp (GRCm38)
  • T to C, chromosome 9 at 73,012,030 bp (GRCm38)
  • T to C, chromosome 9 at 110,986,518 bp (GRCm38)
  • T to C, chromosome 10 at 23,786,879 bp (GRCm38)
  • T to C, chromosome 10 at 76,166,774 bp (GRCm38)
  • T to C, chromosome 10 at 76,354,255 bp (GRCm38)
  • T to A, chromosome 10 at 80,549,706 bp (GRCm38)
  • ACC to AC, chromosome 10 at 86,856,697 bp (GRCm38)
  • T to C, chromosome 10 at 127,205,700 bp (GRCm38)
  • G to A, chromosome 11 at 5,281,915 bp (GRCm38)
  • A to T, chromosome 11 at 58,551,487 bp (GRCm38)
  • A to T, chromosome 11 at 107,052,894 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • A to G, chromosome 13 at 85,288,571 bp (GRCm38)
  • A to G, chromosome 13 at 92,342,249 bp (GRCm38)
  • A to G, chromosome 13 at 108,323,910 bp (GRCm38)
  • C to T, chromosome 13 at 120,240,959 bp (GRCm38)
  • A to G, chromosome 14 at 52,313,767 bp (GRCm38)
  • A to G, chromosome 14 at 103,076,298 bp (GRCm38)
  • T to C, chromosome 15 at 82,855,675 bp (GRCm38)
  • C to T, chromosome 15 at 100,334,976 bp (GRCm38)
  • T to A, chromosome 16 at 17,336,454 bp (GRCm38)
  • T to C, chromosome 17 at 7,952,563 bp (GRCm38)
  • T to C, chromosome 17 at 36,671,356 bp (GRCm38)
  • G to A, chromosome 17 at 55,897,212 bp (GRCm38)
  • A to G, chromosome 17 at 71,653,499 bp (GRCm38)
  • A to T, chromosome 17 at 74,631,701 bp (GRCm38)
  • T to A, chromosome 19 at 10,210,646 bp (GRCm38)
  • T to A, chromosome 19 at 11,966,226 bp (GRCm38)
  • C to T, chromosome X at 166,536,239 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9648 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069441-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.