Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9648Btlr/Mmmh
Stock Number:
069441-MU
Citation ID:
RRID:MMRRC_069441-MU
Other Names:
R9648 (G1)
Major Collection:

Strain Information

Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Dnajc2
Name: DnaJ heat shock protein family (Hsp40) member C2
Synonyms: MIDA1, Mida1, Zrf1, Zrf2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22791
Homologene: 31656
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: LKB1IP, LIP1, 1200014D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71728
Homologene: 12406
Wdr43
Name: WD repeat domain 43
Synonyms: 2610318G08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72515
VEGA: 17
Homologene: 38810
Dido1
Name: death inducer-obliterator 1
Synonyms: DIO-1, 6720461J16Rik, D130048F08Rik, Datf1, dido, C130092D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Rexo1
Name: REX1, RNA exonuclease 1
Synonyms: 1700021P10Rik, 2610511M11Rik, Tceb3bp1, Rex1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66932
Homologene: 41391
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Rsrc2
Name: arginine/serine-rich coiled-coil 2
Synonyms: 1500011J06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208606
Homologene: 133892
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Stat1
Name: signal transducer and activator of transcription 1
Synonyms: 2010005J02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20846
Homologene: 21428
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Depdc1b
Name: DEP domain containing 1B
Synonyms: XTP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218581
Homologene: 10157
Rps12
Name: ribosomal protein S12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20042
VEGA: 10
Homologene: 110750
Tlr2
Name: toll-like receptor 2
Synonyms: Ly105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24088
Homologene: 20695
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, 2610108D09Rik, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Cmas
Name: cytidine monophospho-N-acetylneuraminic acid synthetase
Synonyms: CMP-Neu5Ac synthase, D6Bwg0250e, CMP-sialic acid synthetase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12764
Homologene: 7670
Pip4k2c
Name: phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Synonyms: Pip5k2c
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117150
VEGA: 10
Homologene: 23484
Icam1
Name: intercellular adhesion molecule 1
Synonyms: CD54, MALA-2, Icam-1, Ly-47
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15894
VEGA: 9
HGNC: HGNC:5344
Homologene: 168
Tcf20
Name: transcription factor 20
Synonyms: SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21411
VEGA: 15
Homologene: 4131
Egfl6
Name: EGF-like-domain, multiple 6
Synonyms: Maeg
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 54156
HGNC: HGNC:3235
Homologene: 9166
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Osbp
Name: oxysterol binding protein
Synonyms: 1110018F06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76303
VEGA: 19
HGNC: HGNC:8503
Homologene: 97668
Rasa1
Name: RAS p21 protein activator 1
Synonyms: p120-rasGAP, Gap
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218397
HGNC: HGNC:9871
Homologene: 2168
Msh3
Name: mutS homolog 3
Synonyms: D13Em1, Rep-3, Rep3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17686
HGNC: HGNC:7326
Homologene: 1829
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407821
Homologene: 46592
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Serpind1
Name: serine (or cysteine) peptidase inhibitor, clade D, member 1
Synonyms: HC II, Hcf2, HCII, heparin cofactor II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15160
HGNC: HGNC:4838
Homologene: 36018
Cnbd1
Name: cyclic nucleotide binding domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435772
Homologene: 27843
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pld1
Name: phospholipase D1
Synonyms: Pld1b, Pld1a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18805
HGNC: HGNC:9067
Homologene: 116234
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232854
Homologene: 119890
Il12rb2
Name: interleukin 12 receptor, beta 2
Synonyms: IL-12RB2, Ifnm, A930027I18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16162
HGNC: HGNC:5972
Homologene: 1197
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Gramd1b
Name: GRAM domain containing 1B
Synonyms: A930008A22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235283
Homologene: 18223
Slc5a4a
Name: solute carrier family 5, member 4a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64452
VEGA: 10
Slco1b2
Name: solute carrier organic anion transporter family, member 1b2
Synonyms: mlst-1, Slc21a6, Slc21a10, Oatp1b2, 7330442B20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28253
Homologene: 75119
Foxa2
Name: forkhead box A2
Synonyms: Hnf-3b, Tcf-3b, Tcf3b, Hnf3b, HNF3beta, HNF3-beta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15376
HGNC: HGNC:5022
Homologene: 7762
Or7g17
Name: olfactory receptor family 7 subfamily G member 17
Synonyms: GA_x6K02T2PVTD-12599710-12600648, MOR147-1, Olfr829
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259070
HGNC: HGNC:8466
Homologene: 138324
Zfp518b
Name: zinc finger protein 518B
Synonyms: 6820424L24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100515
Homologene: 19115
Spdye4a
Name: speedy/RINGO cell cycle regulator family, member E4A
Synonyms: 4930445A17Rik, speedy/ringo, speedy B, 4930451F05Rik, Spdyb
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74673
Homologene: 134531
Trim50
Name: tripartite motif-containing 50
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215061
Homologene: 14548
Zfp959
Name: zinc finger protein 959
Synonyms: BC011426
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224893
Homologene: 138295
H2-M1
Name: histocompatibility 2, M region locus 1
Synonyms: Mb1, H-2M1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224756
Homologene: 110792
Dnm1
Name: dynamin 1
Synonyms: dynamin 1, Ftfl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13429
HGNC: HGNC:2972
Homologene: 123905
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Myrf
Name: myelin regulatory factor
Synonyms: LOC225908, LOC386531, Gm98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Klrb1a
Name: killer cell lectin-like receptor subfamily B member 1A
Synonyms: Nkrp1-a, Ly55a, NKR-P1A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17057
HGNC: HGNC:6373
Homologene: 84369
Rtp3
Name: receptor transporter protein 3
Synonyms: Tmem7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235636
Homologene: 135957
Slc38a11
Name: solute carrier family 38, member 11
Synonyms: 9330158F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320106
Homologene: 5775
Rsph3a
Name: radial spoke 3A homolog (Chlamydomonas)
Synonyms: 4930524H12Rik, 1700012G05Rik, Rshl2, Rshl2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66832
VEGA: 17
Homologene: 12043
Or2t47
Name: olfactory receptor family 2 subfamily T member 47
Synonyms: GA_x6K02T2NKPP-873285-874217, MOR275-2, Olfr328
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258495
Homologene: 133015
Ccpg1
Name: cell cycle progression 1
Synonyms: 1700030B06Rik, 1810073J13Rik, D9Ertd392e, 9430028F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72278
Homologene: 3487
Tmt1a3
Name: thiol methyltransferase 1A3
Synonyms: Gm10035, Mettl7a3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 668178
VEGA: 15
Homologene: 117485
Plppr2
Name: phospholipid phosphatase related 2
Synonyms: PRG-4, BC018242, Lppr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235044
Homologene: 11229
Cln5
Name: ceroid-lipofuscinosis, neuronal 5
Synonyms: A730075N08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211286
VEGA: 14
HGNC: HGNC:2076
Homologene: 4738
Adgra2
Name: adhesion G protein-coupled receptor A2
Synonyms: Tem5, 9530074E10Rik, 8430414O08Rik, Gpr124
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78560
Homologene: 13112
Sall2
Name: spalt like transcription factor 2
Synonyms: Msal-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50524
Homologene: 9269
Fut7
Name: fucosyltransferase 7
Synonyms: Fuc-TVII, FTVII, FucT-VII
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14347
HGNC: HGNC:4018
Homologene: 3296
Tcstv7b
Name: Tcstv family member 7B
Synonyms: Gm21731
Type: Gene
Species: Mouse
Chromosome: 13
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 52,126,536 bp (GRCm38)
  • A to T, chromosome 1 at 53,275,125 bp (GRCm38)
  • A to G, chromosome 1 at 75,528,941 bp (GRCm38)
  • T to A, chromosome 2 at 25,425,324 bp (GRCm38)
  • T to A, chromosome 2 at 32,340,443 bp (GRCm38)
  • T to A, chromosome 2 at 65,358,140 bp (GRCm38)
  • A to G, chromosome 2 at 67,516,255 bp (GRCm38)
  • T to A, chromosome 2 at 76,789,462 bp (GRCm38)
  • T to A, chromosome 2 at 148,045,879 bp (GRCm38)
  • T to C, chromosome 2 at 172,249,719 bp (GRCm38)
  • C to A, chromosome 2 at 180,660,675 bp (GRCm38)
  • A to G, chromosome 3 at 19,256,802 bp (GRCm38)
  • T to A, chromosome 3 at 28,120,751 bp (GRCm38)
  • A to T, chromosome 3 at 63,301,005 bp (GRCm38)
  • A to T, chromosome 3 at 83,838,533 bp (GRCm38)
  • A to C, chromosome 4 at 19,098,142 bp (GRCm38)
  • C to T, chromosome 4 at 88,676,823 bp (GRCm38)
  • G to A, chromosome 5 at 21,763,480 bp (GRCm38)
  • C to G, chromosome 5 at 38,672,897 bp (GRCm38)
  • A to G, chromosome 5 at 123,739,625 bp (GRCm38)
  • T to A, chromosome 5 at 134,255,916 bp (GRCm38)
  • T to A, chromosome 5 at 135,366,621 bp (GRCm38)
  • A to C, chromosome 5 at 137,407,730 bp (GRCm38)
  • C to T, chromosome 5 at 143,225,093 bp (GRCm38)
  • T to A, chromosome 6 at 35,225,811 bp (GRCm38)
  • T to C, chromosome 6 at 67,356,603 bp (GRCm38)
  • C to T, chromosome 6 at 113,803,746 bp (GRCm38)
  • C to A, chromosome 6 at 121,358,702 bp (GRCm38)
  • T to C, chromosome 6 at 128,609,853 bp (GRCm38)
  • T to C, chromosome 6 at 141,656,929 bp (GRCm38)
  • T to A, chromosome 6 at 142,771,209 bp (GRCm38)
  • G to A, chromosome 7 at 7,182,172 bp (GRCm38)
  • A to G, chromosome 7 at 92,658,110 bp (GRCm38)
  • A to G, chromosome 8 at 13,223,245 bp (GRCm38)
  • G to A, chromosome 8 at 27,119,144 bp (GRCm38)
  • T to C, chromosome 9 at 15,323,607 bp (GRCm38)
  • T to A, chromosome 9 at 18,857,452 bp (GRCm38)
  • T to C, chromosome 9 at 21,026,401 bp (GRCm38)
  • T to A, chromosome 9 at 21,941,083 bp (GRCm38)
  • A to T, chromosome 9 at 40,333,497 bp (GRCm38)
  • T to C, chromosome 9 at 73,012,030 bp (GRCm38)
  • T to C, chromosome 9 at 110,986,518 bp (GRCm38)
  • T to C, chromosome 10 at 23,786,879 bp (GRCm38)
  • T to C, chromosome 10 at 76,166,774 bp (GRCm38)
  • T to C, chromosome 10 at 76,354,255 bp (GRCm38)
  • T to A, chromosome 10 at 80,549,706 bp (GRCm38)
  • ACC to AC, chromosome 10 at 86,856,697 bp (GRCm38)
  • T to C, chromosome 10 at 127,205,700 bp (GRCm38)
  • G to A, chromosome 11 at 5,281,915 bp (GRCm38)
  • A to T, chromosome 11 at 58,551,487 bp (GRCm38)
  • A to T, chromosome 11 at 107,052,894 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • A to G, chromosome 13 at 85,288,571 bp (GRCm38)
  • A to G, chromosome 13 at 92,342,249 bp (GRCm38)
  • A to G, chromosome 13 at 108,323,910 bp (GRCm38)
  • C to T, chromosome 13 at 120,240,959 bp (GRCm38)
  • A to G, chromosome 14 at 52,313,767 bp (GRCm38)
  • A to G, chromosome 14 at 103,076,298 bp (GRCm38)
  • T to C, chromosome 15 at 82,855,675 bp (GRCm38)
  • C to T, chromosome 15 at 100,334,976 bp (GRCm38)
  • T to A, chromosome 16 at 17,336,454 bp (GRCm38)
  • T to C, chromosome 17 at 7,952,563 bp (GRCm38)
  • T to C, chromosome 17 at 36,671,356 bp (GRCm38)
  • G to A, chromosome 17 at 55,897,212 bp (GRCm38)
  • A to G, chromosome 17 at 71,653,499 bp (GRCm38)
  • A to T, chromosome 17 at 74,631,701 bp (GRCm38)
  • T to A, chromosome 19 at 10,210,646 bp (GRCm38)
  • T to A, chromosome 19 at 11,966,226 bp (GRCm38)
  • C to T, chromosome X at 166,536,239 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9648 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069441-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.