Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9649Btlr/Mmmh
Stock Number:
069442-MU
Citation ID:
RRID:MMRRC_069442-MU
Other Names:
R9649 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Cdh1
Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Ctnnal1
Name: catenin alpha like 1
Synonyms: ACRP, Catnal1, catenin (cadherin associated protein), alpha-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Zmynd8
Name: zinc finger, MYND-type containing 8
Synonyms: 1110013E22Rik, 2010005I16Rik, ZMYND8, RACK7, 3632413B07Rik, Prkcbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228880
HGNC: HGNC:9397
Homologene: 32679
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to C, chromosome 1 at 39,683,690 bp (GRCm38)
  • G to T, chromosome 1 at 119,526,883 bp (GRCm38)
  • C to T, chromosome 1 at 191,098,426 bp (GRCm38)
  • T to A, chromosome 2 at 13,574,892 bp (GRCm38)
  • T to C, chromosome 2 at 24,974,469 bp (GRCm38)
  • G to A, chromosome 2 at 28,469,752 bp (GRCm38)
  • G to A, chromosome 2 at 31,402,438 bp (GRCm38)
  • T to C, chromosome 2 at 85,868,934 bp (GRCm38)
  • T to A, chromosome 2 at 85,869,475 bp (GRCm38)
  • T to C, chromosome 2 at 90,400,994 bp (GRCm38)
  • C to G, chromosome 2 at 91,508,569 bp (GRCm38)
  • C to A, chromosome 2 at 120,696,154 bp (GRCm38)
  • A to T, chromosome 2 at 165,838,852 bp (GRCm38)
  • A to T, chromosome 2 at 173,719,913 bp (GRCm38)
  • A to G, chromosome 3 at 87,384,611 bp (GRCm38)
  • A to C, chromosome 3 at 93,564,283 bp (GRCm38)
  • C to T, chromosome 3 at 96,758,021 bp (GRCm38)
  • A to T, chromosome 3 at 125,914,689 bp (GRCm38)
  • G to T, chromosome 4 at 11,486,045 bp (GRCm38)
  • A to G, chromosome 4 at 56,865,036 bp (GRCm38)
  • A to T, chromosome 4 at 86,824,923 bp (GRCm38)
  • A to G, chromosome 4 at 96,571,956 bp (GRCm38)
  • G to T, chromosome 4 at 99,904,705 bp (GRCm38)
  • A to G, chromosome 4 at 143,816,039 bp (GRCm38)
  • G to A, chromosome 4 at 149,117,819 bp (GRCm38)
  • A to C, chromosome 4 at 149,151,139 bp (GRCm38)
  • A to G, chromosome 4 at 151,131,547 bp (GRCm38)
  • A to T, chromosome 4 at 154,984,059 bp (GRCm38)
  • T to A, chromosome 5 at 5,373,477 bp (GRCm38)
  • C to T, chromosome 5 at 5,575,549 bp (GRCm38)
  • A to G, chromosome 5 at 8,974,170 bp (GRCm38)
  • T to C, chromosome 5 at 45,639,142 bp (GRCm38)
  • T to A, chromosome 5 at 77,007,292 bp (GRCm38)
  • T to A, chromosome 5 at 106,918,463 bp (GRCm38)
  • T to C, chromosome 5 at 121,810,992 bp (GRCm38)
  • T to A, chromosome 5 at 129,862,641 bp (GRCm38)
  • T to A, chromosome 5 at 139,174,154 bp (GRCm38)
  • A to G, chromosome 6 at 88,202,523 bp (GRCm38)
  • A to T, chromosome 6 at 121,787,532 bp (GRCm38)
  • A to G, chromosome 6 at 148,243,216 bp (GRCm38)
  • T to C, chromosome 7 at 3,914,522 bp (GRCm38)
  • G to T, chromosome 7 at 19,426,090 bp (GRCm38)
  • G to T, chromosome 7 at 28,466,830 bp (GRCm38)
  • A to T, chromosome 7 at 43,301,229 bp (GRCm38)
  • G to A, chromosome 7 at 79,427,206 bp (GRCm38)
  • G to C, chromosome 7 at 89,147,978 bp (GRCm38)
  • T to C, chromosome 7 at 102,900,445 bp (GRCm38)
  • T to C, chromosome 7 at 103,564,643 bp (GRCm38)
  • G to A, chromosome 7 at 144,580,647 bp (GRCm38)
  • G to A, chromosome 8 at 22,538,884 bp (GRCm38)
  • A to G, chromosome 8 at 34,838,935 bp (GRCm38)
  • A to T, chromosome 8 at 80,614,516 bp (GRCm38)
  • A to C, chromosome 8 at 106,661,972 bp (GRCm38)
  • T to C, chromosome 8 at 110,110,948 bp (GRCm38)
  • A to T, chromosome 9 at 15,996,758 bp (GRCm38)
  • A to G, chromosome 9 at 21,929,376 bp (GRCm38)
  • A to G, chromosome 9 at 58,312,754 bp (GRCm38)
  • A to G, chromosome 9 at 75,017,067 bp (GRCm38)
  • A to T, chromosome 9 at 75,192,444 bp (GRCm38)
  • T to C, chromosome 9 at 110,386,158 bp (GRCm38)
  • A to T, chromosome 9 at 124,440,831 bp (GRCm38)
  • T to A, chromosome 10 at 9,899,194 bp (GRCm38)
  • C to T, chromosome 10 at 41,267,767 bp (GRCm38)
  • T to A, chromosome 10 at 75,739,405 bp (GRCm38)
  • T to A, chromosome 10 at 77,080,839 bp (GRCm38)
  • ACC to AC, chromosome 10 at 86,856,697 bp (GRCm38)
  • C to A, chromosome 10 at 89,790,731 bp (GRCm38)
  • T to C, chromosome 10 at 127,573,499 bp (GRCm38)
  • T to A, chromosome 10 at 129,333,499 bp (GRCm38)
  • A to G, chromosome 11 at 63,921,505 bp (GRCm38)
  • A to T, chromosome 11 at 68,490,894 bp (GRCm38)
  • A to T, chromosome 11 at 100,472,680 bp (GRCm38)
  • A to T, chromosome 11 at 115,994,345 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • G to A, chromosome 11 at 116,135,074 bp (GRCm38)
  • A to G, chromosome 11 at 119,479,631 bp (GRCm38)
  • A to G, chromosome 11 at 120,010,907 bp (GRCm38)
  • A to T, chromosome 12 at 13,583,416 bp (GRCm38)
  • T to C, chromosome 12 at 14,150,189 bp (GRCm38)
  • T to A, chromosome 12 at 30,075,876 bp (GRCm38)
  • T to C, chromosome 12 at 104,038,058 bp (GRCm38)
  • G to T, chromosome 12 at 114,851,265 bp (GRCm38)
  • C to T, chromosome 13 at 64,064,357 bp (GRCm38)
  • A to T, chromosome 13 at 67,542,528 bp (GRCm38)
  • A to G, chromosome 13 at 111,748,944 bp (GRCm38)
  • T to C, chromosome 14 at 12,597,418 bp (GRCm38)
  • A to G, chromosome 14 at 20,400,478 bp (GRCm38)
  • C to T, chromosome 14 at 23,451,598 bp (GRCm38)
  • T to C, chromosome 14 at 30,915,648 bp (GRCm38)
  • C to A, chromosome 14 at 66,175,705 bp (GRCm38)
  • G to A, chromosome 15 at 76,006,127 bp (GRCm38)
  • A to G, chromosome 15 at 76,182,953 bp (GRCm38)
  • T to A, chromosome 16 at 32,895,102 bp (GRCm38)
  • T to A, chromosome 16 at 57,140,709 bp (GRCm38)
  • G to T, chromosome 17 at 24,753,252 bp (GRCm38)
  • G to A, chromosome 17 at 28,818,623 bp (GRCm38)
  • A to G, chromosome 17 at 29,319,389 bp (GRCm38)
  • A to T, chromosome 17 at 78,491,646 bp (GRCm38)
  • C to T, chromosome 17 at 78,834,095 bp (GRCm38)
  • T to A, chromosome 18 at 9,877,000 bp (GRCm38)
  • T to A, chromosome 18 at 37,767,235 bp (GRCm38)
  • C to T, chromosome 18 at 50,090,445 bp (GRCm38)
  • A to T, chromosome 19 at 9,008,422 bp (GRCm38)
  • C to T, chromosome X at 166,536,239 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9649 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069442-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.