Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9650Btlr/Mmmh
Stock Number:
069443-MU
Citation ID:
RRID:MMRRC_069443-MU
Other Names:
R9650 (G1)
Major Collection:

Strain Information

Hps5
Name: HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonyms: ru-2, ruby eye 2, ru2, Hermansky-Pudlak syndrome 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246694
Homologene: 35333
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Wasf2
Name: WASP family, member 2
Synonyms: D4Ertd13e, WAVE2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242687
Homologene: 86743
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Pnmt
Name: phenylethanolamine-N-methyltransferase
Synonyms: Pent
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18948
HGNC: HGNC:9160
Homologene: 55673
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 67,215,477 bp (GRCm38)
  • C to T, chromosome 1 at 74,425,616 bp (GRCm38)
  • T to A, chromosome 1 at 87,487,830 bp (GRCm38)
  • A to C, chromosome 2 at 25,520,442 bp (GRCm38)
  • A to T, chromosome 2 at 88,987,662 bp (GRCm38)
  • C to T, chromosome 2 at 119,446,983 bp (GRCm38)
  • C to T, chromosome 2 at 131,053,069 bp (GRCm38)
  • T to A, chromosome 2 at 154,552,762 bp (GRCm38)
  • C to T, chromosome 3 at 96,758,021 bp (GRCm38)
  • T to A, chromosome 3 at 126,942,180 bp (GRCm38)
  • G to A, chromosome 4 at 43,545,912 bp (GRCm38)
  • T to C, chromosome 4 at 132,902,076 bp (GRCm38)
  • T to A, chromosome 4 at 133,190,146 bp (GRCm38)
  • G to A, chromosome 5 at 37,300,818 bp (GRCm38)
  • G to T, chromosome 5 at 96,762,528 bp (GRCm38)
  • T to C, chromosome 5 at 123,997,294 bp (GRCm38)
  • T to C, chromosome 5 at 150,445,910 bp (GRCm38)
  • T to C, chromosome 6 at 113,194,186 bp (GRCm38)
  • A to G, chromosome 7 at 5,034,684 bp (GRCm38)
  • G to A, chromosome 7 at 26,766,783 bp (GRCm38)
  • A to G, chromosome 7 at 46,775,930 bp (GRCm38)
  • G to C, chromosome 7 at 89,147,978 bp (GRCm38)
  • T to C, chromosome 7 at 102,877,780 bp (GRCm38)
  • T to C, chromosome 7 at 128,135,763 bp (GRCm38)
  • A to G, chromosome 8 at 12,655,974 bp (GRCm38)
  • A to T, chromosome 9 at 7,174,849 bp (GRCm38)
  • A to T, chromosome 9 at 18,642,466 bp (GRCm38)
  • A to C, chromosome 9 at 35,909,503 bp (GRCm38)
  • C to A, chromosome 9 at 44,089,179 bp (GRCm38)
  • T to A, chromosome 9 at 121,780,017 bp (GRCm38)
  • T to C, chromosome 10 at 12,738,185 bp (GRCm38)
  • A to G, chromosome 10 at 25,493,597 bp (GRCm38)
  • T to A, chromosome 10 at 60,750,523 bp (GRCm38)
  • ACC to AC, chromosome 10 at 86,856,697 bp (GRCm38)
  • G to A, chromosome 10 at 127,091,784 bp (GRCm38)
  • T to A, chromosome 10 at 128,360,987 bp (GRCm38)
  • A to T, chromosome 11 at 46,331,951 bp (GRCm38)
  • T to C, chromosome 11 at 69,805,043 bp (GRCm38)
  • A to T, chromosome 11 at 98,387,436 bp (GRCm38)
  • T to C, chromosome 11 at 107,044,586 bp (GRCm38)
  • T to A, chromosome 11 at 110,180,620 bp (GRCm38)
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp (GRCm38)
  • A to C, chromosome 12 at 74,976,519 bp (GRCm38)
  • G to A, chromosome 12 at 104,220,260 bp (GRCm38)
  • C to A, chromosome 12 at 108,675,439 bp (GRCm38)
  • G to T, chromosome 12 at 114,851,265 bp (GRCm38)
  • T to A, chromosome 13 at 24,802,139 bp (GRCm38)
  • A to T, chromosome 13 at 50,469,719 bp (GRCm38)
  • A to T, chromosome 13 at 93,708,825 bp (GRCm38)
  • A to T, chromosome 15 at 33,497,259 bp (GRCm38)
  • A to G, chromosome 15 at 39,031,546 bp (GRCm38)
  • A to T, chromosome 15 at 83,119,890 bp (GRCm38)
  • A to T, chromosome 15 at 98,048,367 bp (GRCm38)
  • G to A, chromosome 17 at 34,711,655 bp (GRCm38)
  • T to A, chromosome 18 at 37,727,466 bp (GRCm38)
  • T to G, chromosome 18 at 60,246,398 bp (GRCm38)
  • C to T, chromosome 19 at 4,607,686 bp (GRCm38)
  • A to G, chromosome 19 at 43,746,879 bp (GRCm38)
  • C to G, chromosome X at 169,985,007 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9650 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069443-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.