Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9670Btlr/Mmmh
Stock Number:
069463-MU
Citation ID:
RRID:MMRRC_069463-MU
Other Names:
R9670 (G1)
Major Collection:

Strain Information

Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Brd2
Name: bromodomain containing 2
Synonyms: Ring3, Frg-1, D17H6S113E, Fsrg1, Rnf3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14312
HGNC: HGNC:1103
Homologene: 74540
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56505
Homologene: 37839
Sgk1
Name: serum/glucocorticoid regulated kinase 1
Synonyms: Sgk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20393
Homologene: 48364
Ncbp3
Name: nuclear cap binding subunit 3
Synonyms: 1200014J11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66874
Homologene: 10231
Nup85
Name: nucleoporin 85
Synonyms: frount, Pcnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 445007
HGNC: HGNC:8734
Homologene: 11755
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 58,946,304 bp (GRCm38)
  • C to A, chromosome 1 at 131,753,950 bp (GRCm38)
  • A to T, chromosome 1 at 134,630,502 bp (GRCm38)
  • T to C, chromosome 1 at 150,450,867 bp (GRCm38)
  • A to G, chromosome 1 at 188,628,571 bp (GRCm38)
  • C to A, chromosome 2 at 32,213,187 bp (GRCm38)
  • A to G, chromosome 2 at 69,002,770 bp (GRCm38)
  • C to A, chromosome 2 at 112,730,500 bp (GRCm38)
  • C to A, chromosome 2 at 152,760,690 bp (GRCm38)
  • T to C, chromosome 3 at 89,345,963 bp (GRCm38)
  • A to G, chromosome 3 at 138,065,133 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • A to T, chromosome 5 at 143,254,593 bp (GRCm38)
  • A to C, chromosome 5 at 146,556,566 bp (GRCm38)
  • T to A, chromosome 6 at 83,487,017 bp (GRCm38)
  • T to C, chromosome 6 at 88,467,576 bp (GRCm38)
  • A to G, chromosome 7 at 10,714,724 bp (GRCm38)
  • G to T, chromosome 7 at 122,633,847 bp (GRCm38)
  • A to T, chromosome 8 at 126,456,523 bp (GRCm38)
  • AAGA to AAGAGA, chromosome 10 at 21,992,391 bp (GRCm38)
  • T to A, chromosome 11 at 73,053,497 bp (GRCm38)
  • T to C, chromosome 11 at 78,074,584 bp (GRCm38)
  • C to T, chromosome 11 at 115,566,645 bp (GRCm38)
  • A to G, chromosome 11 at 117,155,232 bp (GRCm38)
  • T to C, chromosome 12 at 72,567,018 bp (GRCm38)
  • A to T, chromosome 13 at 76,384,721 bp (GRCm38)
  • A to T, chromosome 14 at 5,944,993 bp (GRCm38)
  • T to C, chromosome 14 at 8,140,748 bp (GRCm38)
  • C to A, chromosome 14 at 20,528,246 bp (GRCm38)
  • T to C, chromosome 14 at 33,047,262 bp (GRCm38)
  • T to A, chromosome 14 at 37,068,158 bp (GRCm38)
  • G to A, chromosome 14 at 67,008,765 bp (GRCm38)
  • T to G, chromosome 14 at 70,129,560 bp (GRCm38)
  • T to A, chromosome 16 at 10,240,648 bp (GRCm38)
  • T to C, chromosome 17 at 8,801,440 bp (GRCm38)
  • T to A, chromosome 17 at 23,312,124 bp (GRCm38)
  • T to C, chromosome 17 at 34,115,231 bp (GRCm38)
  • T to C, chromosome 19 at 12,429,743 bp (GRCm38)
  • A to G, chromosome 19 at 25,171,562 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9670 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069463-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.