Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9670Btlr/Mmmh
Stock Number:
069463-MU
Citation ID:
RRID:MMRRC_069463-MU
Other Names:
R9670 (G1)
Major Collection:

Strain Information

Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Brd2
Name: bromodomain containing 2
Synonyms: Ring3, Frg-1, D17H6S113E, Fsrg1, Rnf3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14312
HGNC: HGNC:1103
Homologene: 74540
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56505
Homologene: 37839
Sgk1
Name: serum/glucocorticoid regulated kinase 1
Synonyms: Sgk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20393
Homologene: 48364
Ncbp3
Name: nuclear cap binding subunit 3
Synonyms: 1200014J11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66874
Homologene: 10231
Nup85
Name: nucleoporin 85
Synonyms: frount, Pcnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 445007
HGNC: HGNC:8734
Homologene: 11755
Bnip3l
Name: BCL2/adenovirus E1B interacting protein 3-like
Synonyms: Nix, D14Ertd719e, Nip3L
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12177
HGNC: HGNC:1085
Homologene: 3195
Pxk
Name: PX domain containing serine/threonine kinase
Synonyms: C230080L11Rik, D14Ertd813e, MONaKA
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218699
VEGA: 14
Homologene: 9828
Ppp3cb
Name: protein phosphatase 3, catalytic subunit, beta isoform
Synonyms: PP2BA beta, Calnb, CnAbeta, 1110063J16Rik, Cnab
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19056
HGNC: HGNC:9315
Homologene: 56429
Atf7ip2
Name: activating transcription factor 7 interacting protein 2
Synonyms: 4930558K11Rik, PSM2, Get-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75329
Homologene: 23509
Prkcb
Name: protein kinase C, beta
Synonyms: Pkcb, A130082F03Rik, PKC-Beta, Prkcb2, Prkcb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18751
HGNC: HGNC:9395
Homologene: 56424
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Adam15
Name: ADAM metallopeptidase domain 15
Synonyms: metargidin, MDC15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11490
HGNC: HGNC:193
Homologene: 2829
Tarbp1
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212728
Homologene: 38082
Eral1
Name: Era like 12S mitochondrial rRNA chaperone 1
Synonyms: MERA-S, MERA-W, 9130407C09Rik, 2610524P08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57837
HGNC: HGNC:3424
Homologene: 4167
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Pcnx4
Name: pecanex homolog 4
Synonyms: 1810048J11Rik, Pcnxl4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Sec14l1
Name: SEC14-like lipid binding 1
Synonyms: 1200017E04Rik, 2810012L19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74136
Homologene: 37719
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Prg4
Name: proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms: MSF, DOL54, lubricin, SZP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96875
HGNC: HGNC:9364
Homologene: 137352
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 666002
Homologene: 86604
Lrit2
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Synonyms: A930010E21Rik, Lrrc22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239038
VEGA: 14
Homologene: 18292
Mctp1
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78771
Homologene: 75211
Pfpl
Name: pore forming protein-like
Synonyms: Epcs5, Epcs50
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56093
VEGA: 19
Homologene: 130704
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Zfp316
Name: zinc finger protein 316
Synonyms: Emzf1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54201
Homologene: 69231
Cox4i2
Name: cytochrome c oxidase subunit 4I2
Synonyms: Cox IV-2, Cox4b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 84682
Homologene: 13082
Bin3
Name: bridging integrator 3
Synonyms: 1700015F07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57784
VEGA: 14
HGNC: HGNC:1054
Homologene: 5472
Cers6
Name: ceramide synthase 6
Synonyms: T1L, similar to TRH1, 4732462C07Rik, CerS6, Lass6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241447
Homologene: 72228
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320718
Homologene: 14179
Dguok
Name: deoxyguanosine kinase
Synonyms: dGK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27369
HGNC: HGNC:2858
Homologene: 8456
Gm3248
Name: predicted gene 3248
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100041279
Homologene: 115686
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 58,946,304 bp (GRCm38)
  • C to A, chromosome 1 at 131,753,950 bp (GRCm38)
  • A to T, chromosome 1 at 134,630,502 bp (GRCm38)
  • T to C, chromosome 1 at 150,450,867 bp (GRCm38)
  • A to G, chromosome 1 at 188,628,571 bp (GRCm38)
  • C to A, chromosome 2 at 32,213,187 bp (GRCm38)
  • A to G, chromosome 2 at 69,002,770 bp (GRCm38)
  • C to A, chromosome 2 at 112,730,500 bp (GRCm38)
  • C to A, chromosome 2 at 152,760,690 bp (GRCm38)
  • T to C, chromosome 3 at 89,345,963 bp (GRCm38)
  • A to G, chromosome 3 at 138,065,133 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • A to T, chromosome 5 at 143,254,593 bp (GRCm38)
  • A to C, chromosome 5 at 146,556,566 bp (GRCm38)
  • T to A, chromosome 6 at 83,487,017 bp (GRCm38)
  • T to C, chromosome 6 at 88,467,576 bp (GRCm38)
  • A to G, chromosome 7 at 10,714,724 bp (GRCm38)
  • G to T, chromosome 7 at 122,633,847 bp (GRCm38)
  • A to T, chromosome 8 at 126,456,523 bp (GRCm38)
  • AAGA to AAGAGA, chromosome 10 at 21,992,391 bp (GRCm38)
  • T to A, chromosome 11 at 73,053,497 bp (GRCm38)
  • T to C, chromosome 11 at 78,074,584 bp (GRCm38)
  • C to T, chromosome 11 at 115,566,645 bp (GRCm38)
  • A to G, chromosome 11 at 117,155,232 bp (GRCm38)
  • T to C, chromosome 12 at 72,567,018 bp (GRCm38)
  • A to T, chromosome 13 at 76,384,721 bp (GRCm38)
  • A to T, chromosome 14 at 5,944,993 bp (GRCm38)
  • T to C, chromosome 14 at 8,140,748 bp (GRCm38)
  • C to A, chromosome 14 at 20,528,246 bp (GRCm38)
  • T to C, chromosome 14 at 33,047,262 bp (GRCm38)
  • T to A, chromosome 14 at 37,068,158 bp (GRCm38)
  • G to A, chromosome 14 at 67,008,765 bp (GRCm38)
  • T to G, chromosome 14 at 70,129,560 bp (GRCm38)
  • T to A, chromosome 16 at 10,240,648 bp (GRCm38)
  • T to C, chromosome 17 at 8,801,440 bp (GRCm38)
  • T to A, chromosome 17 at 23,312,124 bp (GRCm38)
  • T to C, chromosome 17 at 34,115,231 bp (GRCm38)
  • T to C, chromosome 19 at 12,429,743 bp (GRCm38)
  • A to G, chromosome 19 at 25,171,562 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9670 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069463-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.