Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9679Btlr/Mmmh
Stock Number:
069472-MU
Citation ID:
RRID:MMRRC_069472-MU
Other Names:
R9679 (G1)
Major Collection:

Strain Information

Jade1
Name: jade family PHD finger 1
Synonyms: D530048A03Rik, Phf17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269424
Homologene: 18162
Taf8
Name: TATA-box binding protein associated factor 8
Synonyms: Taf8, Tbn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63856
VEGA: 17
Homologene: 11094
Mrpl14
Name: mitochondrial ribosomal protein L14
Synonyms: MRP-L32, Rpml32, 1110006I11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68463
Homologene: 12268
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Slc16a3
Name: solute carrier family 16 (monocarboxylic acid transporters), member 3
Synonyms: MCT3, monocarboxylate transporter 4, MCT4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80879
Homologene: 37900
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 36,318,567 bp (GRCm38)
  • C to A, chromosome 1 at 74,430,674 bp (GRCm38)
  • A to G, chromosome 1 at 159,892,038 bp (GRCm38)
  • T to A, chromosome 2 at 4,893,294 bp (GRCm38)
  • A to G, chromosome 2 at 26,924,352 bp (GRCm38)
  • G to T, chromosome 2 at 52,716,570 bp (GRCm38)
  • T to A, chromosome 2 at 85,722,138 bp (GRCm38)
  • A to G, chromosome 2 at 111,329,000 bp (GRCm38)
  • T to A, chromosome 2 at 152,869,698 bp (GRCm38)
  • T to C, chromosome 3 at 41,613,134 bp (GRCm38)
  • G to T, chromosome 3 at 83,354,390 bp (GRCm38)
  • A to G, chromosome 5 at 38,527,873 bp (GRCm38)
  • G to A, chromosome 6 at 42,286,819 bp (GRCm38)
  • A to C, chromosome 7 at 5,221,231 bp (GRCm38)
  • T to G, chromosome 7 at 10,715,257 bp (GRCm38)
  • T to C, chromosome 7 at 45,627,903 bp (GRCm38)
  • T to C, chromosome 7 at 80,383,302 bp (GRCm38)
  • T to C, chromosome 7 at 86,811,533 bp (GRCm38)
  • T to C, chromosome 7 at 103,155,445 bp (GRCm38)
  • T to A, chromosome 7 at 137,231,235 bp (GRCm38)
  • T to C, chromosome 8 at 12,859,388 bp (GRCm38)
  • G to A, chromosome 8 at 23,227,116 bp (GRCm38)
  • T to A, chromosome 8 at 72,763,033 bp (GRCm38)
  • T to C, chromosome 8 at 82,344,465 bp (GRCm38)
  • C to T, chromosome 9 at 31,410,089 bp (GRCm38)
  • T to C, chromosome 9 at 66,090,720 bp (GRCm38)
  • T to C, chromosome 9 at 108,573,159 bp (GRCm38)
  • T to A, chromosome 9 at 123,479,392 bp (GRCm38)
  • A to G, chromosome 10 at 129,776,013 bp (GRCm38)
  • T to A, chromosome 11 at 23,444,369 bp (GRCm38)
  • T to G, chromosome 11 at 32,190,853 bp (GRCm38)
  • T to C, chromosome 11 at 53,990,773 bp (GRCm38)
  • T to C, chromosome 11 at 120,956,397 bp (GRCm38)
  • C to A, chromosome 12 at 28,594,830 bp (GRCm38)
  • T to A, chromosome 12 at 113,545,922 bp (GRCm38)
  • C to A, chromosome 13 at 64,751,748 bp (GRCm38)
  • T to A, chromosome 13 at 100,043,777 bp (GRCm38)
  • A to G, chromosome 13 at 112,895,521 bp (GRCm38)
  • G to A, chromosome 14 at 67,781,001 bp (GRCm38)
  • A to G, chromosome 15 at 36,087,441 bp (GRCm38)
  • C to T, chromosome 15 at 101,776,717 bp (GRCm38)
  • A to T, chromosome 16 at 14,277,572 bp (GRCm38)
  • A to G, chromosome 16 at 59,036,158 bp (GRCm38)
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp (GRCm38)
  • T to C, chromosome 17 at 21,287,024 bp (GRCm38)
  • CA to CAA, chromosome 17 at 24,527,763 bp (GRCm38)
  • A to G, chromosome 17 at 30,818,141 bp (GRCm38)
  • A to G, chromosome 17 at 35,619,599 bp (GRCm38)
  • A to G, chromosome 17 at 45,698,314 bp (GRCm38)
  • C to T, chromosome 17 at 47,490,176 bp (GRCm38)
  • A to G, chromosome 18 at 58,068,361 bp (GRCm38)
  • A to T, chromosome 18 at 74,359,585 bp (GRCm38)
  • A to C, chromosome 19 at 4,841,271 bp (GRCm38)
  • A to G, chromosome 19 at 11,302,684 bp (GRCm38)
  • T to C, chromosome 19 at 23,374,016 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9679 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069472-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.