Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9679Btlr/Mmmh
Stock Number:
069472-MU
Citation ID:
RRID:MMRRC_069472-MU
Other Names:
R9679 (G1)
Major Collection:

Strain Information

Jade1
Name: jade family PHD finger 1
Synonyms: D530048A03Rik, Phf17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269424
Homologene: 18162
Taf8
Name: TATA-box binding protein associated factor 8
Synonyms: Taf8, Tbn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63856
VEGA: 17
Homologene: 11094
Mrpl14
Name: mitochondrial ribosomal protein L14
Synonyms: MRP-L32, Rpml32, 1110006I11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68463
Homologene: 12268
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Slc16a3
Name: solute carrier family 16 (monocarboxylic acid transporters), member 3
Synonyms: MCT3, monocarboxylate transporter 4, MCT4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80879
Homologene: 37900
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Sephs1
Name: selenophosphate synthetase 1
Synonyms: SPS1, 1110046B24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109079
Homologene: 56558
Tpx2
Name: TPX2, microtubule-associated
Synonyms: REPP86, DIL2, p100, 2610005B21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72119
HGNC: HGNC:1249
Homologene: 8107
Wdr1
Name: WD repeat domain 1
Synonyms: D5Wsu185e, Aip1, rede
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22388
Homologene: 6628
Mtrex
Name: Mtr4 exosome RNA helicase
Synonyms: 2610528A15Rik, Skiv2l2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72198
VEGA: 13
Homologene: 6257
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
F2rl3
Name: F2R like thrombin or trypsin receptor 3
Synonyms: PAR4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14065
HGNC: HGNC:3540
Homologene: 36148
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Gins4
Name: GINS complex subunit 4
Synonyms: 4933405K01Rik, SLD5, 2810037C03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109145
Homologene: 5759
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Traf7
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224619
Homologene: 12998
Ebf3
Name: early B cell factor 3
Synonyms: O/E-2, Olf-1/EBF-like 2, 3110018A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Colec11
Name: collectin sub-family member 11
Synonyms: 1010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71693
VEGA: 12
Homologene: 11423
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 383435
Homologene: 138453
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Limd1
Name: LIM domains containing 1
Synonyms: D9Ertd192e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 29806
VEGA: 9
HGNC: HGNC:6612
Homologene: 8478
Wdr6
Name: WD repeat domain 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83669
Homologene: 117682
Il15
Name: interleukin 15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16168
HGNC: HGNC:5977
Homologene: 487
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: SMCC1, Clc-1, Clc1, NMF355, nmf355
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Slc22a4
Name: solute carrier family 22 (organic cation transporter), member 4
Synonyms: Octn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30805
Homologene: 81701
Tnr
Name: tenascin R
Synonyms: janusin, restrictin, TN-R, J1-tenascin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21960
Homologene: 124416
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Cfap53
Name: cilia and flagella associated protein 53
Synonyms: 4933415I03Rik, Ccdc11
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74453
Homologene: 27056
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546983
Homologene: 115466
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Or4k37
Name: olfactory receptor family 4 subfamily K member 37
Synonyms: GA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P, Olfr1281
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257979
Homologene: 73992
Krt72
Name: keratin 72
Synonyms: K6irs2, Krt72-ps
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105866
Homologene: 25876
Arid5a
Name: AT-rich interaction domain 5A
Synonyms: Mrf1, D430024K22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214855
Homologene: 34940
Mamdc2
Name: MAM domain containing 2
Synonyms: 1200015L10Rik, mamcan
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71738
VEGA: 19
Homologene: 17722
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Vil1
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22349
Homologene: 5169
Fes
Name: feline sarcoma oncogene
Synonyms: c-fes
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14159
HGNC: HGNC:3657
Homologene: 37563
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 4930558F19Rik, 9130422H11Rik, LOC100045280
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50770
Homologene: 75050
Rasip1
Name: Ras interacting protein 1
Synonyms: 2610025P08Rik, Rain
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69903
Homologene: 9847
Or5h19
Name: olfactory receptor family 5 subfamily H member 19
Synonyms: GA_x54KRFPKG5P-55265713-55264787, MOR183-8, Olfr187
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258319
Homologene: 133069
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Or6c76
Name: olfactory receptor family 6 subfamily C member 76
Synonyms: GA_x6K02T2PULF-11454600-11455541, MOR108-4, Olfr809
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258321
Homologene: 138308
Vmn1r236
Name: vomeronasal 1 receptor 236
Synonyms: V1rf4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171235
Or5g9
Name: olfactory receptor family 5 subfamily G member 9
Synonyms: GA_x6K02T2Q125-47195323-47196267, MOR175-3, Olfr1009
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258565
Homologene: 17297
Surf4
Name: surfeit gene 4
Synonyms: Surf-4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20932
Homologene: 6052
Ccdc87
Name: coiled-coil domain containing 87
Synonyms: 4931419P11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 399599
VEGA: 19
Homologene: 49531
Vmn1r57
Name: vomeronasal 1 receptor 57
Synonyms: Gm7519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665150
Homologene: 41799
Or52e2
Name: olfactory receptor family 52 subfamily E member 2
Synonyms: GA_x6K02T2PBJ9-5871256-5870303, MOR32-3, Olfr589
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259054
Homologene: 133046
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 36,318,567 bp (GRCm38)
  • C to A, chromosome 1 at 74,430,674 bp (GRCm38)
  • A to G, chromosome 1 at 159,892,038 bp (GRCm38)
  • T to A, chromosome 2 at 4,893,294 bp (GRCm38)
  • A to G, chromosome 2 at 26,924,352 bp (GRCm38)
  • G to T, chromosome 2 at 52,716,570 bp (GRCm38)
  • T to A, chromosome 2 at 85,722,138 bp (GRCm38)
  • A to G, chromosome 2 at 111,329,000 bp (GRCm38)
  • T to A, chromosome 2 at 152,869,698 bp (GRCm38)
  • T to C, chromosome 3 at 41,613,134 bp (GRCm38)
  • G to T, chromosome 3 at 83,354,390 bp (GRCm38)
  • A to G, chromosome 5 at 38,527,873 bp (GRCm38)
  • G to A, chromosome 6 at 42,286,819 bp (GRCm38)
  • A to C, chromosome 7 at 5,221,231 bp (GRCm38)
  • T to G, chromosome 7 at 10,715,257 bp (GRCm38)
  • T to C, chromosome 7 at 45,627,903 bp (GRCm38)
  • T to C, chromosome 7 at 80,383,302 bp (GRCm38)
  • T to C, chromosome 7 at 86,811,533 bp (GRCm38)
  • T to C, chromosome 7 at 103,155,445 bp (GRCm38)
  • T to A, chromosome 7 at 137,231,235 bp (GRCm38)
  • T to C, chromosome 8 at 12,859,388 bp (GRCm38)
  • G to A, chromosome 8 at 23,227,116 bp (GRCm38)
  • T to A, chromosome 8 at 72,763,033 bp (GRCm38)
  • T to C, chromosome 8 at 82,344,465 bp (GRCm38)
  • C to T, chromosome 9 at 31,410,089 bp (GRCm38)
  • T to C, chromosome 9 at 66,090,720 bp (GRCm38)
  • T to C, chromosome 9 at 108,573,159 bp (GRCm38)
  • T to A, chromosome 9 at 123,479,392 bp (GRCm38)
  • A to G, chromosome 10 at 129,776,013 bp (GRCm38)
  • T to A, chromosome 11 at 23,444,369 bp (GRCm38)
  • T to G, chromosome 11 at 32,190,853 bp (GRCm38)
  • T to C, chromosome 11 at 53,990,773 bp (GRCm38)
  • T to C, chromosome 11 at 120,956,397 bp (GRCm38)
  • C to A, chromosome 12 at 28,594,830 bp (GRCm38)
  • T to A, chromosome 12 at 113,545,922 bp (GRCm38)
  • C to A, chromosome 13 at 64,751,748 bp (GRCm38)
  • T to A, chromosome 13 at 100,043,777 bp (GRCm38)
  • A to G, chromosome 13 at 112,895,521 bp (GRCm38)
  • G to A, chromosome 14 at 67,781,001 bp (GRCm38)
  • A to G, chromosome 15 at 36,087,441 bp (GRCm38)
  • C to T, chromosome 15 at 101,776,717 bp (GRCm38)
  • A to T, chromosome 16 at 14,277,572 bp (GRCm38)
  • A to G, chromosome 16 at 59,036,158 bp (GRCm38)
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp (GRCm38)
  • T to C, chromosome 17 at 21,287,024 bp (GRCm38)
  • CA to CAA, chromosome 17 at 24,527,763 bp (GRCm38)
  • A to G, chromosome 17 at 30,818,141 bp (GRCm38)
  • A to G, chromosome 17 at 35,619,599 bp (GRCm38)
  • A to G, chromosome 17 at 45,698,314 bp (GRCm38)
  • C to T, chromosome 17 at 47,490,176 bp (GRCm38)
  • A to G, chromosome 18 at 58,068,361 bp (GRCm38)
  • A to T, chromosome 18 at 74,359,585 bp (GRCm38)
  • A to C, chromosome 19 at 4,841,271 bp (GRCm38)
  • A to G, chromosome 19 at 11,302,684 bp (GRCm38)
  • T to C, chromosome 19 at 23,374,016 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9679 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069472-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.