Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Pex7em4Lutzy/Mmjax
Stock Number:
069598-JAX
Citation ID:
RRID:MMRRC_069598-JAX
Other Names:
Pex7del580, C57BL/6J-Pex7em4Lutzy/Mmjax

Strain Information

Pex7em4Lutzy
Name: peroxisomal biogenesis factor 7; endonuclease-mediated mutation 7, Cathy Lutz
Synonyms: Pex7del580
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: CRISPR
Pex7
Name: peroxisomal biogenesis factor 7
Synonyms: peroxisome biogenesis factor 7
Type: Gene
Species: Mouse
Chromosome: 10
Alteration at locus: CRISPR
NCBI: 18634
HGNC: HGNC:8860
Homologene: 242
Genetic Alterations
CRISPR-mediated deletion
Genotype Determination
ES Cell Line
Not applicable
Phenotype
Homozygous mice are embryonic-or-perinatal lethal.

The Pex7 (peroxisomal biogenesis factor 7) gene encodes a member of the peroxisomal assembly (PEX) proteins and is involved in the transport of enzymes for the assembly and function of peroxisomes. Mutations in this gene are associated with peroxisome biogenesis disorders (PBDs).
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Metabolism
  • Models for Human Disease
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish
Strain Development
The Pex7em4Lutzy (Pex7del580) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs [ACCTCCTTTCAGTTTAACTT, AGCTCCAAAGTTAAACTGAA, AGTGCCTCTAGCAGGCACGG, and GATGCCACCGTGCCTGCTAG] were selected to target exon 3 of the peroxisomal biogenesis factor 7 (Pex7) on Chromosome 10. Donor DNAs were originally designed to introduce loxP sites flanking exon 3 as described for MMRRC Stock No. 069597. DNA sequencing of the targeted region identified founder 5022 with a 580-bp deletion that includes exon 3. These sequences and Cas9 nuclease were introduced into C57BL/6J zygotes and then transferred to pseudopregnant females. The founder was bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for a total of at least two generations.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross and sib-mating
Generation
N3 (C57BL/6J), F?
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: No No
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069598-JAX-SPERM Cryo-preserved spermatozoa $459.00 / Non-Profit Aliquot Approximate quantity3
069598-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.