Strain Name:
C57BL/6J-MtgxR9746Btlr/Mmmh
Stock Number:
069992-MU
Citation ID:
RRID:MMRRC_069992-MU
Other Names:
R9746 (G1)
Major Collection:

Strain Information

Gulo
Name: gulonolactone (L-) oxidase
Synonyms: L-gulono-gamma-lactone oxidase, sfx
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268756
VEGA: 14
HGNC: HGNC:4695
Homologene: 6566
Ep400
Name: E1A binding protein p400
Synonyms: 1700020J09Rik, mDomino, p400
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Uri1
Name: URI1, prefoldin-like chaperone
Synonyms: Rmp, NNX3, C80913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19777
Homologene: 2813
Nub1
Name: negative regulator of ubiquitin-like proteins 1
Synonyms: 4931404D21Rik, NY-REN-18, 6330412F12Rik, BS4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53312
Homologene: 41108
Actn4
Name: actinin alpha 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60595
HGNC: HGNC:166
Homologene: 55857
Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Nup188
Name: nucleoporin 188
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227699
Homologene: 45683
Syngr1
Name: synaptogyrin 1
Synonyms: Syngr1b, p29
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20972
Homologene: 3456
Ppp1r13b
Name: protein phosphatase 1, regulatory subunit 13B
Synonyms: ASPP1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21981
VEGA: 12
Homologene: 9090
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: Mtssk, MAST205
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: Ltpr7, 2310022G15Rik, LTRPC7, 5033407O22Rik, TRP-PLIK, CHAK, CHAK1, 4833414K03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, Mphosph1, magoo, 33cex, C330014J10Rik, Kif20b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Tars2
Name: threonyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms: 2610024N01Rik, Tarsl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71807
Homologene: 23520
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 9030205D12Rik, 1810014J18Rik, AD013, A330063D19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Orc2
Name: origin recognition complex, subunit 2
Synonyms: Orc2l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18393
HGNC: HGNC:8488
Homologene: 4512
Klhl7
Name: kelch-like 7
Synonyms: D5Ertd363e, 2700038B03Rik, Klhl6, SBBI26
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52323
Homologene: 10317
Sin3a
Name: transcriptional regulator, SIN3A (yeast)
Synonyms: mSin3A, Sin3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20466
Homologene: 32124
Afdn
Name: afadin, adherens junction formation factor
Synonyms: 5033403D15Rik, Mllt4, Afadin, I-afadin, S-afadin, AF6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Atg2b
Name: autophagy related 2B
Synonyms: C630028L02Rik, 2410024A21Rik, C030004M05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Ptn
Name: pleiotrophin
Synonyms: HB-GAM, Osf1, heparin-binding growth-associated molecule, HBGF-8, Osf-1, heparin-binding growth factor 8, HBNF
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19242
HGNC: HGNC:9630
Homologene: 2117
Rapsn
Name: receptor-associated protein of the synapse
Synonyms: Raps, 43kDa acetylcholine receptor-associated protein, Nraps, rapsyn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19400
HGNC: HGNC:9863
Homologene: 3708
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 2810487N22Rik, B130055D15Rik, 4632407J06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Rpf1
Name: ribosome production factor 1 homolog
Synonyms: 2210420E24Rik, 2310066N05Rik, Bxdc5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70285
Homologene: 68728
Rps15a
Name: ribosomal protein S15A
Synonyms: A630031B11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 267019
Homologene: 128982
Ackr1
Name: atypical chemokine receptor 1 (Duffy blood group)
Synonyms: CCBP1, Dfy, Darc, FY, ESTM35, CD234
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13349
HGNC: HGNC:4035
Homologene: 48067
Grm4
Name: glutamate receptor, metabotropic 4
Synonyms: Gprc1d, mGluR4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268934
HGNC: HGNC:4596
Homologene: 20230
Rasal1
Name: RAS protein activator like 1 (GAP1 like)
Synonyms: MRASAL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19415
HGNC: HGNC:9873
Homologene: 3423
Cir1
Name: corepressor interacting with RBPJ, 1
Synonyms: 2810021A19Rik, CIR, 1700023B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66935
Homologene: 3589
Map2k3
Name: mitogen-activated protein kinase kinase 3
Synonyms: MKK3, Prkmk3, MAP kinase kinase 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26397
HGNC: HGNC:6843
Homologene: 56430
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: A930031B09Rik, D330024H06Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Nptx2
Name: neuronal pentraxin 2
Synonyms: np2, narp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53324
HGNC: HGNC:7953
Homologene: 1892
Sgta
Name: small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Synonyms: Sgt, D10Ertd190e, 5330427H01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52551
VEGA: 10
Homologene: 31122
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Acf1, Wcrf180
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Dtwd1
Name: DTW domain containing 1
Synonyms: 1810033A06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69185
Homologene: 10633
Hectd3
Name: HECT domain E3 ubiquitin protein ligase 3
Synonyms: 1700064K09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76608
Homologene: 18426
Slc12a9
Name: solute carrier family 12 (potassium/chloride transporters), member 9
Synonyms: CIP1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83704
Homologene: 5429
Rdx
Name: radixin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19684
VEGA: 9
HGNC: HGNC:9944
Homologene: 37707
Nr1d1
Name: nuclear receptor subfamily 1, group D, member 1
Synonyms: rev-erbA(alpha), REV-ERBalpha, A530070C09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217166
HGNC: HGNC:7962
Homologene: 23324
Myo15a
Name: myosin XVA
Synonyms: Myo15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Ltbr
Name: lymphotoxin B receptor
Synonyms: TNF receptor-related protein, TNF-R-III, Tnfrsf3, LT-beta receptor, Tnfbr, Ltar, TNFRrp, LT beta-R, TNFCR, LTbetaR, TNFR2-RP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17000
HGNC: HGNC:6718
Homologene: 1753
Trp73
Name: transformation related protein 73
Synonyms: deltaNp73, p73, TAp73
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22062
Homologene: 3960
Nadk2
Name: NAD kinase 2, mitochondrial
Synonyms: Nadkd1, MNADK, 4933430B08Rik, 1110020G09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68646
Homologene: 14638
Tub
Name: TUB bipartite transcription factor
Synonyms: rd5, tub
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22141
Homologene: 31147
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: b2b1289Clo, b2b1203Clo, Dnahc11, b2b1279Clo, avc4, b2b1727Clo, b2b598Clo, lrd
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Slc4a8
Name: solute carrier family 4 (anion exchanger), member 8
Synonyms: NDCBE, sodium bicarbonate cotransporter isoform 3 kNBC-3, KNBC-3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 59033
Homologene: 68419
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Tbx15
Name: T-box 15
Synonyms: de, Tbx8, Tbx14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21384
Homologene: 7967
Galnt18
Name: polypeptide N-acetylgalactosaminyltransferase 18
Synonyms: Galntl4, 2900011G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233733
Homologene: 18347
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Fhod1
Name: formin homology 2 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234686
Homologene: 136406
Ttc23l
Name: tetratricopeptide repeat domain 23-like
Synonyms: 4930401A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75777
Homologene: 44907
Parvg
Name: parvin, gamma
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64099
Homologene: 11151
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Gabrb2
Name: gamma-aminobutyric acid type A receptor subunit beta 2
Synonyms: C030002O17Rik, C030021G16Rik, Gabrb-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14401
HGNC: HGNC:4082
Homologene: 7327
Pcdha1
Name: protocadherin alpha 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 116731
HGNC: HGNC:8663
Homologene: 75093
Capn8
Name: calpain 8
Synonyms: nCL-2, nCL-2'
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170725
HGNC: HGNC:1485
Homologene: 15643
Npr2
Name: natriuretic peptide receptor 2
Synonyms: pwe, cn, guanylyl cyclase-B
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Or2d36
Name: olfactory receptor family 2 subfamily D member 36
Synonyms: MOR260-2, GA_x6K02T2PBJ9-9497411-9498355, Olfr716
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258597
Homologene: 121514
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Mpo
Name: myeloperoxidase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17523
HGNC: HGNC:7218
Homologene: 55450
Krt13
Name: keratin 13
Synonyms: Krt-1.13, K13, Krt1-13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16663
HGNC: HGNC:6415
Homologene: 40740
Cmah
Name: cytidine monophospho-N-acetylneuraminic acid hydroxylase
Synonyms: CMP-NeuAc hydroxylase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12763
HGNC: HGNC:2098
Homologene: 7269
Or6c6c
Name: olfactory receptor family 6 subfamily C member 6C
Synonyms: GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258068
Homologene: 133581
Vmn2r13
Name: vomeronasal 2, receptor 13
Synonyms: Gm4867
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231589
Homologene: 129606
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, Srsf2ip, Sfrs2ip, 2610510E10Rik, SIP1, SRRP129, CASP11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
H2-M1
Name: histocompatibility 2, M region locus 1
Synonyms: Mb1, H-2M1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224756
Homologene: 110792
Dpm1
Name: dolichyl-phosphate mannosyltransferase subunit 1, catalytic
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13480
HGNC: HGNC:3005
Homologene: 2865
Or5e1
Name: olfactory receptor family 5 subfamily E member 1
Synonyms: MOR195-1, Olfr513, GA_x6K02T2PBJ9-11084889-11085818
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258718
Homologene: 64908
Angpt1
Name: angiopoietin 1
Synonyms: Ang-1, 1110046O21Rik, Angiopoietin-1, ang1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11600
VEGA: 15
HGNC: HGNC:484
Homologene: 37447
Hs6st3
Name: heparan sulfate 6-O-sulfotransferase 3
Synonyms: 6OST3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50787
VEGA: 14
Homologene: 89201
Pramel26
Name: PRAME like 26
Synonyms: Gm13084
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381569
Homologene: 77858
Epb42
Name: erythrocyte membrane protein band 4.2
Synonyms: Epb4.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13828
HGNC: HGNC:3381
Homologene: 93
Cdr1
Name: cerebellar degeneration related antigen 1
Synonyms: Gm7077, Gm2409, Cdr34
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 631990
VEGA: X
HGNC: HGNC:1798
Serpinb3b
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3B
Synonyms: Scca2-rs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383548
Homologene: 131278
Tgm4
Name: transglutaminase 4 (prostate)
Synonyms: experimental autoimmune prostatitis antigen 1, 9530008N10Rik, Eapa1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331046
Homologene: 20689
Or5m8
Name: olfactory receptor family 5 subfamily M member 8
Synonyms: MOR200-1, GA_x6K02T2Q125-47470765-47471775, Olfr1031
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257916
Homologene: 73973
Psg16
Name: pregnancy specific beta-1-glycoprotein 16
Synonyms: Cea11, bCEA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26436
Pak1ip1
Name: PAK1 interacting protein 1
Synonyms: Gdpd1, 5830431I15Rik, p21-activated protein kinase-interacting protein 1, 5930415H02Rik, PIP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68083
Homologene: 39574
Usp16
Name: ubiquitin specific peptidase 16
Synonyms: 1200004E02Rik, 2810483I07Rik, 6330514E22Rik, UBP-M
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74112
Homologene: 38183
Nck2
Name: non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms: Grb4, NCKbeta, 4833426I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17974
HGNC: HGNC:7665
Homologene: 20794
Slc26a3
Name: solute carrier family 26, member 3
Synonyms: Dra, 9030623B18Rik, 9130013M11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13487
HGNC: HGNC:3018
Homologene: 55435
Acnat1
Name: acyl-coenzyme A amino acid N-acyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230161
Homologene: 28287
Tmem253
Name: transmembrane protein 253
Synonyms: G630016D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 619301
VEGA: 14
Homologene: 83921
Zfp111
Name: zinc finger protein 111
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56707
Homologene: 128597
Rwdd2b
Name: RWD domain containing 2B
Synonyms: ORF5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 53858
HGNC: HGNC:1302
Homologene: 9654
Ly6g
Name: lymphocyte antigen 6 family member G
Synonyms: Ly-6G, Gr1, Gr-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 546644
Homologene: 113718
Gprin2
Name: G protein regulated inducer of neurite outgrowth 2
Synonyms: C130040D06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432839
VEGA: 14
Homologene: 40975
Vmn1r12
Name: vomeronasal 1 receptor 12
Synonyms: Gm6674
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 626397
Homologene: 74373
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Cnpy1
Name: canopy FGF signaling regulator 1
Synonyms: 9630008K15Rik, 1500012D20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269637
Homologene: 89678
Dnajb4
Name: DnaJ heat shock protein family (Hsp40) member B4
Synonyms: 2010306G19Rik, 5730460G06Rik, 1700029A20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67035
Homologene: 100610
Gm29106
Name: predicted gene 29106
Type: Gene
Species: Mouse
Chromosome: 1
Or8c19-ps1
Name: olfactory receptor family 8 subfamily C member 19, pseudogene1
Synonyms: MOR170-7, GA_x6K02T2PVTD-31999710-32000653, Olfr897-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258473
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 40,365,359 bp (GRCm38)
  • T to A, chromosome 1 at 43,533,732 bp (GRCm38)
  • C to T, chromosome 1 at 58,497,451 bp (GRCm38)
  • T to A, chromosome 1 at 107,154,673 bp (GRCm38)
  • T to A, chromosome 1 at 118,199,524 bp (GRCm38)
  • T to A, chromosome 1 at 173,332,031 bp (GRCm38)
  • G to A, chromosome 1 at 182,611,105 bp (GRCm38)
  • T to A, chromosome 2 at 30,304,288 bp (GRCm38)
  • G to A, chromosome 2 at 73,303,808 bp (GRCm38)
  • A to G, chromosome 2 at 85,992,747 bp (GRCm38)
  • C to T, chromosome 2 at 91,045,478 bp (GRCm38)
  • A to T, chromosome 2 at 121,024,610 bp (GRCm38)
  • A to G, chromosome 2 at 126,154,675 bp (GRCm38)
  • A to G, chromosome 2 at 126,822,658 bp (GRCm38)
  • A to T, chromosome 2 at 168,230,387 bp (GRCm38)
  • A to T, chromosome 3 at 95,754,765 bp (GRCm38)
  • A to G, chromosome 3 at 99,352,331 bp (GRCm38)
  • A to G, chromosome 3 at 146,517,778 bp (GRCm38)
  • A to G, chromosome 3 at 152,186,683 bp (GRCm38)
  • G to A, chromosome 4 at 43,633,527 bp (GRCm38)
  • A to T, chromosome 4 at 49,450,652 bp (GRCm38)
  • A to C, chromosome 4 at 116,311,730 bp (GRCm38)
  • T to C, chromosome 4 at 116,995,754 bp (GRCm38)
  • T to C, chromosome 4 at 143,810,316 bp (GRCm38)
  • G to A, chromosome 4 at 154,081,402 bp (GRCm38)
  • A to G, chromosome 5 at 24,126,820 bp (GRCm38)
  • T to G, chromosome 5 at 24,703,485 bp (GRCm38)
  • T to C, chromosome 5 at 28,245,802 bp (GRCm38)
  • C to T, chromosome 5 at 109,191,907 bp (GRCm38)
  • C to T, chromosome 5 at 110,742,006 bp (GRCm38)
  • G to A, chromosome 5 at 120,662,293 bp (GRCm38)
  • G to A, chromosome 5 at 137,321,409 bp (GRCm38)
  • T to A, chromosome 5 at 144,548,140 bp (GRCm38)
  • T to G, chromosome 6 at 36,715,764 bp (GRCm38)
  • A to G, chromosome 6 at 57,159,541 bp (GRCm38)
  • A to G, chromosome 6 at 125,313,101 bp (GRCm38)
  • A to G, chromosome 7 at 17,098,161 bp (GRCm38)
  • G to A, chromosome 7 at 24,198,642 bp (GRCm38)
  • A to T, chromosome 7 at 28,919,006 bp (GRCm38)
  • A to C, chromosome 7 at 37,996,685 bp (GRCm38)
  • A to G, chromosome 7 at 81,476,344 bp (GRCm38)
  • A to T, chromosome 7 at 107,147,453 bp (GRCm38)
  • A to G, chromosome 7 at 108,755,432 bp (GRCm38)
  • A to C, chromosome 7 at 109,025,638 bp (GRCm38)
  • A to T, chromosome 7 at 111,471,961 bp (GRCm38)
  • A to T, chromosome 7 at 118,109,997 bp (GRCm38)
  • G to A, chromosome 8 at 91,011,435 bp (GRCm38)
  • A to G, chromosome 8 at 105,337,416 bp (GRCm38)
  • G to A, chromosome 9 at 27,063,359 bp (GRCm38)
  • T to A, chromosome 9 at 38,309,632 bp (GRCm38)
  • A to G, chromosome 9 at 52,063,578 bp (GRCm38)
  • T to A, chromosome 9 at 57,118,074 bp (GRCm38)
  • A to T, chromosome 9 at 64,894,511 bp (GRCm38)
  • A to T, chromosome 9 at 123,046,569 bp (GRCm38)
  • T to A, chromosome 10 at 41,924,461 bp (GRCm38)
  • T to C, chromosome 10 at 81,051,284 bp (GRCm38)
  • T to C, chromosome 10 at 92,801,219 bp (GRCm38)
  • A to T, chromosome 10 at 129,705,339 bp (GRCm38)
  • C to T, chromosome 11 at 30,876,868 bp (GRCm38)
  • A to T, chromosome 11 at 42,626,609 bp (GRCm38)
  • C to A, chromosome 11 at 60,487,408 bp (GRCm38)
  • G to A, chromosome 11 at 60,932,103 bp (GRCm38)
  • A to G, chromosome 11 at 69,907,475 bp (GRCm38)
  • T to G, chromosome 11 at 87,803,523 bp (GRCm38)
  • T to C, chromosome 11 at 98,770,334 bp (GRCm38)
  • T to A, chromosome 11 at 100,121,161 bp (GRCm38)
  • T to A, chromosome 12 at 31,449,146 bp (GRCm38)
  • CCATT to CCATTCATT, chromosome 12 at 54,975,110 bp (GRCm38)
  • G to T, chromosome 12 at 105,663,938 bp (GRCm38)
  • G to T, chromosome 12 at 111,833,808 bp (GRCm38)
  • T to A, chromosome 12 at 117,878,576 bp (GRCm38)
  • T to C, chromosome 13 at 24,435,690 bp (GRCm38)
  • T to A, chromosome 13 at 41,009,267 bp (GRCm38)
  • G to T, chromosome 14 at 34,195,658 bp (GRCm38)
  • A to G, chromosome 14 at 52,017,982 bp (GRCm38)
  • C to A, chromosome 14 at 65,988,181 bp (GRCm38)
  • G to A, chromosome 14 at 119,869,080 bp (GRCm38)
  • C to T, chromosome 15 at 9,106,736 bp (GRCm38)
  • G to A, chromosome 15 at 10,523,643 bp (GRCm38)
  • A to T, chromosome 15 at 42,676,441 bp (GRCm38)
  • T to C, chromosome 15 at 75,158,609 bp (GRCm38)
  • G to A, chromosome 15 at 80,091,458 bp (GRCm38)
  • T to G, chromosome 15 at 84,326,223 bp (GRCm38)
  • G to A, chromosome 15 at 96,420,417 bp (GRCm38)
  • C to A, chromosome 15 at 100,783,840 bp (GRCm38)
  • G to A, chromosome 16 at 87,436,753 bp (GRCm38)
  • C to T, chromosome 16 at 87,479,232 bp (GRCm38)
  • A to C, chromosome 17 at 13,846,520 bp (GRCm38)
  • A to T, chromosome 17 at 23,401,823 bp (GRCm38)
  • A to T, chromosome 17 at 27,438,791 bp (GRCm38)
  • A to C, chromosome 17 at 36,670,105 bp (GRCm38)
  • T to A, chromosome 18 at 36,932,660 bp (GRCm38)
  • G to T, chromosome 19 at 25,409,508 bp (GRCm38)
  • T to A, chromosome 19 at 34,950,749 bp (GRCm38)
  • T to C, chromosome 19 at 53,013,461 bp (GRCm38)
  • AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC to AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC, chromosome X at 61,184,524 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9746 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069992-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.