Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9749Btlr/Mmmh
Stock Number:
069995-MU
Citation ID:
RRID:MMRRC_069995-MU
Other Names:
R9749 (G1)
Major Collection:

Strain Information

Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Ube2g1
Name: ubiquitin-conjugating enzyme E2G 1
Synonyms: 2700059C12Rik, D130023C12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67128
Homologene: 2508
Rngtt
Name: RNA guanylyltransferase and 5'-phosphatase
Synonyms: mouse capping enzyme
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24018
Homologene: 37851
Cilk1
Name: ciliogenesis associated kinase 1
Synonyms: 2210420N10Rik, Ick
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56542
Homologene: 69218
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71517
Homologene: 10659
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Bcl2l13
Name: BCL2 like 13
Synonyms: BCL-RAMBO, Mil1, E430016C20Rik, Mil-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94044
Homologene: 9111
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 13,570,014 bp (GRCm38)
  • A to G, chromosome 1 at 66,505,020 bp (GRCm38)
  • T to A, chromosome 1 at 66,721,811 bp (GRCm38)
  • A to G, chromosome 1 at 82,485,632 bp (GRCm38)
  • A to C, chromosome 1 at 150,756,588 bp (GRCm38)
  • A to T, chromosome 1 at 155,953,239 bp (GRCm38)
  • A to T, chromosome 1 at 180,694,746 bp (GRCm38)
  • T to C, chromosome 2 at 20,849,215 bp (GRCm38)
  • A to T, chromosome 2 at 25,680,022 bp (GRCm38)
  • G to A, chromosome 2 at 80,571,224 bp (GRCm38)
  • C to A, chromosome 2 at 84,872,610 bp (GRCm38)
  • T to C, chromosome 2 at 86,607,565 bp (GRCm38)
  • A to C, chromosome 2 at 87,809,858 bp (GRCm38)
  • T to A, chromosome 2 at 89,418,318 bp (GRCm38)
  • T to A, chromosome 2 at 103,455,100 bp (GRCm38)
  • T to A, chromosome 2 at 180,183,640 bp (GRCm38)
  • G to A, chromosome 3 at 54,194,881 bp (GRCm38)
  • C to T, chromosome 3 at 93,324,077 bp (GRCm38)
  • T to C, chromosome 3 at 95,684,147 bp (GRCm38)
  • A to G, chromosome 3 at 138,125,228 bp (GRCm38)
  • A to G, chromosome 4 at 33,368,618 bp (GRCm38)
  • T to A, chromosome 4 at 44,307,067 bp (GRCm38)
  • A to G, chromosome 4 at 117,864,001 bp (GRCm38)
  • C to T, chromosome 4 at 126,323,651 bp (GRCm38)
  • A to T, chromosome 4 at 128,496,128 bp (GRCm38)
  • A to G, chromosome 4 at 132,074,718 bp (GRCm38)
  • C to A, chromosome 4 at 156,173,657 bp (GRCm38)
  • G to A, chromosome 5 at 121,869,717 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • G to A, chromosome 6 at 43,217,324 bp (GRCm38)
  • A to G, chromosome 6 at 69,544,424 bp (GRCm38)
  • T to C, chromosome 6 at 77,243,872 bp (GRCm38)
  • T to C, chromosome 6 at 90,318,269 bp (GRCm38)
  • T to C, chromosome 6 at 115,742,345 bp (GRCm38)
  • T to C, chromosome 6 at 120,865,672 bp (GRCm38)
  • G to T, chromosome 6 at 132,778,143 bp (GRCm38)
  • A to T, chromosome 7 at 4,957,334 bp (GRCm38)
  • A to T, chromosome 7 at 12,176,523 bp (GRCm38)
  • C to A, chromosome 7 at 23,540,812 bp (GRCm38)
  • A to T, chromosome 7 at 26,939,290 bp (GRCm38)
  • A to G, chromosome 7 at 45,007,152 bp (GRCm38)
  • A to G, chromosome 7 at 82,450,186 bp (GRCm38)
  • T to C, chromosome 7 at 86,719,700 bp (GRCm38)
  • C to A, chromosome 7 at 118,752,884 bp (GRCm38)
  • C to A, chromosome 7 at 143,695,571 bp (GRCm38)
  • T to C, chromosome 8 at 70,087,074 bp (GRCm38)
  • T to A, chromosome 8 at 83,241,710 bp (GRCm38)
  • A to G, chromosome 8 at 104,548,422 bp (GRCm38)
  • T to A, chromosome 9 at 27,045,577 bp (GRCm38)
  • T to A, chromosome 9 at 78,153,717 bp (GRCm38)
  • T to G, chromosome 9 at 78,684,884 bp (GRCm38)
  • T to C, chromosome 9 at 95,937,650 bp (GRCm38)
  • T to C, chromosome 9 at 105,861,991 bp (GRCm38)
  • C to A, chromosome 10 at 85,949,589 bp (GRCm38)
  • T to A, chromosome 10 at 121,378,152 bp (GRCm38)
  • A to G, chromosome 10 at 127,688,329 bp (GRCm38)
  • A to G, chromosome 11 at 66,095,376 bp (GRCm38)
  • A to T, chromosome 11 at 67,811,653 bp (GRCm38)
  • T to A, chromosome 11 at 72,189,695 bp (GRCm38)
  • A to T, chromosome 11 at 72,679,373 bp (GRCm38)
  • A to T, chromosome 12 at 57,654,773 bp (GRCm38)
  • A to G, chromosome 12 at 108,806,491 bp (GRCm38)
  • C to A, chromosome 12 at 116,447,748 bp (GRCm38)
  • G to A, chromosome 13 at 21,501,345 bp (GRCm38)
  • T to C, chromosome 13 at 46,760,751 bp (GRCm38)
  • A to G, chromosome 13 at 67,542,454 bp (GRCm38)
  • T to C, chromosome 13 at 68,625,855 bp (GRCm38)
  • T to A, chromosome 14 at 30,919,322 bp (GRCm38)
  • T to C, chromosome 14 at 54,953,486 bp (GRCm38)
  • T to A, chromosome 14 at 70,151,279 bp (GRCm38)
  • A to G, chromosome 15 at 75,863,562 bp (GRCm38)
  • A to G, chromosome 15 at 79,029,017 bp (GRCm38)
  • A to T, chromosome 15 at 83,541,339 bp (GRCm38)
  • A to T, chromosome 16 at 19,487,363 bp (GRCm38)
  • T to C, chromosome 16 at 21,921,831 bp (GRCm38)
  • A to G, chromosome 16 at 37,556,828 bp (GRCm38)
  • A to G, chromosome 16 at 38,308,125 bp (GRCm38)
  • T to C, chromosome 16 at 72,308,369 bp (GRCm38)
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp (GRCm38)
  • C to T, chromosome 17 at 55,608,415 bp (GRCm38)
  • G to A, chromosome X at 101,258,349 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9749 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069995-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.