Strain Name:
C57BL/6J-MtgxR9793Btlr/Mmmh
Stock Number:
070038-MU
Citation ID:
RRID:MMRRC_070038-MU
Other Names:
R9793 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: PC-1, PC1, polycystin-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: Dopey2, 0610038M01Rik, 2610510B01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: CDK11-p46, CDK11-p58, Cdc2l1, CDK11-p110, Cdc2l2, PITSLRE proteins
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Agrn
Name: agrin
Synonyms: NMF380, nmf380, Agrin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Srrt
Name: serrate RNA effector molecule homolog (Arabidopsis)
Synonyms: Asr2, Ars2, 2810019G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83701
Homologene: 9298
Rasgrp1
Name: RAS guanyl releasing protein 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19419
HGNC: HGNC:9878
Homologene: 4195
Wdr26
Name: WD repeat domain 26
Synonyms: Gid7, 1600024A01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226757
Homologene: 11857
Cald1
Name: caldesmon 1
Synonyms: C920027I18Rik, 4833423D12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109624
HGNC: HGNC:1441
Homologene: 137254
Kif26a
Name: kinesin family member 26A
Synonyms: N-11 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668303
Homologene: 18970
Nsd2
Name: nuclear receptor binding SET domain protein 2
Synonyms: Whsc1, D930023B08Rik, 5830445G22Rik, Whsc1l, 9430010A17Rik, C130020C13Rik, D030027O06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107823
Homologene: 26175
Ermard
Name: ER membrane associated RNA degradation
Synonyms: 2210404J11Rik, 2410011O22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381062
Homologene: 19936
Rex2
Name: reduced expression 2
Synonyms: Gm13138
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100043034
Homologene: 133076
Sidt2
Name: SID1 transmembrane family, member 2
Synonyms: CGI-40
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214597
Homologene: 22943
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: CC1, adenomatosis polyposis coli, Min
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Cdk12
Name: cyclin dependent kinase 12
Synonyms: D11Ertd752e, 1810022J16Rik, Crkrs, Crk7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69131
Homologene: 128632
Ncoa2
Name: nuclear receptor coactivator 2
Synonyms: glucocorticoid receptor-interacting protein 1, bHLHe75, TIF-2, TIF2, D1Ertd433e, KAT13C, SRC-2, TIF2/GRIP-1, Grip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17978
HGNC: HGNC:7669
Homologene: 4768
Ppip5k2
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Cfap160, Vip2, Hisppd1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227399
Homologene: 49409
Pcdh17
Name: protocadherin 17
Synonyms: LOC219228, C030033F14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219228
VEGA: 14
Homologene: 8700
Hmcn1
Name: hemicentin 1
Synonyms: EG545370, LOC240793
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: fibrocystin L, PKHDL1, D86 mRNA
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Or4a78
Name: olfactory receptor family 4 subfamily A member 78
Synonyms: MOR231-15P, Olfr1251, GA_x6K02T2Q125-51109312-51108356, MOR231-24_p
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259145
Homologene: 74065
Afap1l1
Name: actin filament associated protein 1-like 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106877
Homologene: 18728
Cfap53
Name: cilia and flagella associated protein 53
Synonyms: Ccdc11, 4933415I03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74453
Homologene: 27056
Add2
Name: adducin 2
Synonyms: 2900072M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11519
HGNC: HGNC:244
Homologene: 1221
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Otud7a
Name: OTU domain containing 7A
Synonyms: Otud7, Cezanne 2 protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170711
Homologene: 15642
Vwa3a
Name: von Willebrand factor A domain containing 3A
Synonyms: E030013G06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233813
Homologene: 18607
Ttc23l
Name: tetratricopeptide repeat domain 23-like
Synonyms: 4930401A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75777
Homologene: 44907
Grik3
Name: glutamate receptor, ionotropic, kainate 3
Synonyms: Glur-7, Glur7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14807
HGNC: HGNC:4581
Homologene: 73901
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap1a, Mtap1, 6330416M19Rik, Mtap-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: Gm600, LOC239151, SLIP-GC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Slc6a7
Name: solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Synonyms: Prot
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240332
VEGA: 18
Homologene: 8592
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Trim42
Name: tripartite motif-containing 42
Synonyms: 4930486B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78911
Homologene: 12712
Or8h9
Name: olfactory receptor family 8 subfamily H member 9
Synonyms: GA_x6K02T2Q125-48446067-48445129, MOR206-3, Olfr1099
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258764
Homologene: 107003
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Vmn2r118
Name: vomeronasal 2, receptor 118
Synonyms: EG383258, Vmn2r119, EG668547
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383258
Homologene: 129687
Rbm20
Name: RNA binding motif protein 20
Synonyms: 1110018J23Rik, 2010003H22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73713
Homologene: 28386
Or2y1
Name: olfactory receptor family 2 subfamily Y member 1
Synonyms: GA_x6K02T2QP88-5941817-5940888, Olfr1385, Olfr1549-ps1, MOR256-41P, MOR256-42P, MOR256-42P
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258027
Homologene: 86692
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668101
Homologene: 82993
Glipr1l2
Name: GLI pathogenesis-related 1 like 2
Synonyms: 4921508O11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67537
Homologene: 17579
Aldh3a1
Name: aldehyde dehydrogenase family 3, subfamily A1
Synonyms: Ahd-4, Aldh3, Aldh, Ahd4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11670
HGNC: HGNC:405
Homologene: 20175
Or5b113
Name: olfactory receptor family 5 subfamily B member 113
Synonyms: MOR202-15, Olfr1467, GA_x6K02T2RE5P-3695694-3696620
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258686
Homologene: 133888
Lrriq3
Name: leucine-rich repeats and IQ motif containing 3
Synonyms: 4933403H06Rik, Lrrc44, 4930511J15Rik, 4930438B07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74435
Homologene: 23668
Or52m1
Name: olfactory receptor family 52 subfamily M member 1
Synonyms: Olfr554, GA_x6K02T2PBJ9-5356887-5357840, MOR25-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258322
Homologene: 105158
Rsl1d1
Name: ribosomal L1 domain containing 1
Synonyms: 2410005K20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66409
Homologene: 41052
Hao1
Name: hydroxyacid oxidase 1, liver
Synonyms: Gox1, GOX, Hao-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15112
HGNC: HGNC:4809
Homologene: 6578
Pacsin3
Name: protein kinase C and casein kinase substrate in neurons 3
Synonyms: 4921507A02Rik, 6330413E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80708
HGNC: HGNC:8572
Homologene: 41117
Cyp4a30b
Name: cytochrome P450, family 4, subfamily a, polypeptide 30b
Synonyms: Cyp4a30b-ps, OTTMUSG00000008626
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435802
Ccdc9b
Name: coiled-coil domain containing 9B
Synonyms: A430105I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214239
Homologene: 128188
Iqcf3
Name: IQ motif containing F3
Synonyms: 1700012F17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68265
Homologene: 86789
Or4f14c
Name: olfactory receptor family 4 subfamily F member 14C
Synonyms: MOR245-1, GA_x6K02T2Q125-73157028-73156524, Olfr1315
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404497
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 13,190,131 bp (GRCm38)
  • A to T, chromosome 1 at 97,744,097 bp (GRCm38)
  • G to A, chromosome 1 at 150,732,938 bp (GRCm38)
  • A to G, chromosome 1 at 181,209,247 bp (GRCm38)
  • A to G, chromosome 2 at 13,574,787 bp (GRCm38)
  • T to A, chromosome 2 at 86,958,775 bp (GRCm38)
  • T to C, chromosome 2 at 89,667,467 bp (GRCm38)
  • C to A, chromosome 2 at 91,263,815 bp (GRCm38)
  • T to C, chromosome 2 at 112,110,985 bp (GRCm38)
  • T to C, chromosome 2 at 117,287,948 bp (GRCm38)
  • T to C, chromosome 2 at 118,757,303 bp (GRCm38)
  • T to C, chromosome 2 at 121,290,823 bp (GRCm38)
  • T to A, chromosome 2 at 134,530,632 bp (GRCm38)
  • G to A, chromosome 3 at 15,575,014 bp (GRCm38)
  • T to C, chromosome 3 at 155,187,676 bp (GRCm38)
  • C to T, chromosome 4 at 85,067,561 bp (GRCm38)
  • A to G, chromosome 4 at 115,458,970 bp (GRCm38)
  • A to G, chromosome 4 at 125,632,522 bp (GRCm38)
  • A to C, chromosome 4 at 147,057,582 bp (GRCm38)
  • T to A, chromosome 4 at 155,647,921 bp (GRCm38)
  • A to G, chromosome 4 at 156,176,672 bp (GRCm38)
  • A to G, chromosome 5 at 33,846,145 bp (GRCm38)
  • C to A, chromosome 5 at 53,172,582 bp (GRCm38)
  • A to G, chromosome 5 at 63,806,889 bp (GRCm38)
  • G to C, chromosome 5 at 137,296,573 bp (GRCm38)
  • A to T, chromosome 6 at 34,746,136 bp (GRCm38)
  • A to T, chromosome 6 at 86,101,153 bp (GRCm38)
  • C to T, chromosome 7 at 63,729,097 bp (GRCm38)
  • T to C, chromosome 7 at 81,101,133 bp (GRCm38)
  • G to A, chromosome 7 at 102,640,581 bp (GRCm38)
  • C to A, chromosome 7 at 120,784,084 bp (GRCm38)
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp (GRCm38)
  • A to T, chromosome 7 at 144,621,697 bp (GRCm38)
  • T to C, chromosome 8 at 112,881,725 bp (GRCm38)
  • A to G, chromosome 9 at 45,939,265 bp (GRCm38)
  • A to G, chromosome 9 at 97,363,376 bp (GRCm38)
  • T to A, chromosome 9 at 106,557,515 bp (GRCm38)
  • A to G, chromosome 10 at 112,107,000 bp (GRCm38)
  • A to T, chromosome 11 at 49,495,055 bp (GRCm38)
  • T to C, chromosome 11 at 61,218,101 bp (GRCm38)
  • T to A, chromosome 11 at 98,211,225 bp (GRCm38)
  • C to T, chromosome 12 at 112,176,453 bp (GRCm38)
  • T to C, chromosome 14 at 65,609,896 bp (GRCm38)
  • C to T, chromosome 14 at 84,532,910 bp (GRCm38)
  • T to A, chromosome 15 at 10,537,645 bp (GRCm38)
  • T to C, chromosome 15 at 44,543,587 bp (GRCm38)
  • T to C, chromosome 15 at 86,235,638 bp (GRCm38)
  • T to C, chromosome 15 at 97,800,790 bp (GRCm38)
  • T to C, chromosome 16 at 11,199,436 bp (GRCm38)
  • T to A, chromosome 16 at 93,801,615 bp (GRCm38)
  • T to C, chromosome 17 at 15,061,179 bp (GRCm38)
  • A to G, chromosome 17 at 24,581,198 bp (GRCm38)
  • T to C, chromosome 17 at 55,592,496 bp (GRCm38)
  • A to T, chromosome 17 at 58,102,197 bp (GRCm38)
  • T to A, chromosome 18 at 34,314,575 bp (GRCm38)
  • C to A, chromosome 18 at 61,005,794 bp (GRCm38)
  • T to C, chromosome 18 at 61,741,751 bp (GRCm38)
  • A to G, chromosome 18 at 74,305,670 bp (GRCm38)
  • A to T, chromosome 19 at 13,365,150 bp (GRCm38)
  • C to A, chromosome 19 at 53,864,120 bp (GRCm38)
  • T to C, chromosome Y at 1,364,679 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9793 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
070038-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.