Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9793Btlr/Mmmh
Stock Number:
070038-MU
Citation ID:
RRID:MMRRC_070038-MU
Other Names:
R9793 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: CDK11-p110, PITSLRE proteins, CDK11-p46, CDK11-p58, Cdc2l2, Cdc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Srrt
Name: serrate RNA effector molecule homolog (Arabidopsis)
Synonyms: Asr2, Ars2, 2810019G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83701
Homologene: 9298
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 13,190,131 bp (GRCm38)
  • A to T, chromosome 1 at 97,744,097 bp (GRCm38)
  • G to A, chromosome 1 at 150,732,938 bp (GRCm38)
  • A to G, chromosome 1 at 181,209,247 bp (GRCm38)
  • A to G, chromosome 2 at 13,574,787 bp (GRCm38)
  • T to A, chromosome 2 at 86,958,775 bp (GRCm38)
  • T to C, chromosome 2 at 89,667,467 bp (GRCm38)
  • C to A, chromosome 2 at 91,263,815 bp (GRCm38)
  • T to C, chromosome 2 at 112,110,985 bp (GRCm38)
  • T to C, chromosome 2 at 117,287,948 bp (GRCm38)
  • T to C, chromosome 2 at 118,757,303 bp (GRCm38)
  • T to C, chromosome 2 at 121,290,823 bp (GRCm38)
  • T to A, chromosome 2 at 134,530,632 bp (GRCm38)
  • G to A, chromosome 3 at 15,575,014 bp (GRCm38)
  • T to C, chromosome 3 at 155,187,676 bp (GRCm38)
  • C to T, chromosome 4 at 85,067,561 bp (GRCm38)
  • A to G, chromosome 4 at 115,458,970 bp (GRCm38)
  • A to G, chromosome 4 at 125,632,522 bp (GRCm38)
  • A to C, chromosome 4 at 147,057,582 bp (GRCm38)
  • T to A, chromosome 4 at 155,647,921 bp (GRCm38)
  • A to G, chromosome 4 at 156,176,672 bp (GRCm38)
  • A to G, chromosome 5 at 33,846,145 bp (GRCm38)
  • C to A, chromosome 5 at 53,172,582 bp (GRCm38)
  • A to G, chromosome 5 at 63,806,889 bp (GRCm38)
  • G to C, chromosome 5 at 137,296,573 bp (GRCm38)
  • A to T, chromosome 6 at 34,746,136 bp (GRCm38)
  • A to T, chromosome 6 at 86,101,153 bp (GRCm38)
  • C to T, chromosome 7 at 63,729,097 bp (GRCm38)
  • T to C, chromosome 7 at 81,101,133 bp (GRCm38)
  • G to A, chromosome 7 at 102,640,581 bp (GRCm38)
  • C to A, chromosome 7 at 120,784,084 bp (GRCm38)
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp (GRCm38)
  • A to T, chromosome 7 at 144,621,697 bp (GRCm38)
  • T to C, chromosome 8 at 112,881,725 bp (GRCm38)
  • A to G, chromosome 9 at 45,939,265 bp (GRCm38)
  • A to G, chromosome 9 at 97,363,376 bp (GRCm38)
  • T to A, chromosome 9 at 106,557,515 bp (GRCm38)
  • A to G, chromosome 10 at 112,107,000 bp (GRCm38)
  • A to T, chromosome 11 at 49,495,055 bp (GRCm38)
  • T to C, chromosome 11 at 61,218,101 bp (GRCm38)
  • T to A, chromosome 11 at 98,211,225 bp (GRCm38)
  • C to T, chromosome 12 at 112,176,453 bp (GRCm38)
  • T to C, chromosome 14 at 65,609,896 bp (GRCm38)
  • C to T, chromosome 14 at 84,532,910 bp (GRCm38)
  • T to A, chromosome 15 at 10,537,645 bp (GRCm38)
  • T to C, chromosome 15 at 44,543,587 bp (GRCm38)
  • T to C, chromosome 15 at 86,235,638 bp (GRCm38)
  • T to C, chromosome 15 at 97,800,790 bp (GRCm38)
  • T to C, chromosome 16 at 11,199,436 bp (GRCm38)
  • T to A, chromosome 16 at 93,801,615 bp (GRCm38)
  • T to C, chromosome 17 at 15,061,179 bp (GRCm38)
  • A to G, chromosome 17 at 24,581,198 bp (GRCm38)
  • T to C, chromosome 17 at 55,592,496 bp (GRCm38)
  • A to T, chromosome 17 at 58,102,197 bp (GRCm38)
  • T to A, chromosome 18 at 34,314,575 bp (GRCm38)
  • C to A, chromosome 18 at 61,005,794 bp (GRCm38)
  • T to C, chromosome 18 at 61,741,751 bp (GRCm38)
  • A to G, chromosome 18 at 74,305,670 bp (GRCm38)
  • A to T, chromosome 19 at 13,365,150 bp (GRCm38)
  • C to A, chromosome 19 at 53,864,120 bp (GRCm38)
  • T to C, chromosome Y at 1,364,679 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9793 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
070038-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.