Strain Name:
C57BL/6J-Pacs1em5(PACS1*R201W)Lutzy/Mmjax
Stock Number:
071615-JAX
Citation ID:
RRID:MMRRC_071615-JAX
Other Names:

C57BL/6J-Pacs1em5Lutzy/Mmjax, LSL-huPacs1-exon4 R201W

Strain Information

Pacs1em5(PACS1*R201W)Lutzy
Name: phosphofurin acidic cluster sorting protein 1; endonuclease-mediated mutation 5, Cathleen Lutz
Synonyms: LSL-huPacs1-exon4 R201W
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: CRISPR
Pacs1
Name: phosphofurin acidic cluster sorting protein 1
Type: Gene
Species: Mouse
Chromosome: 19
Alteration at locus: CRISPR
NCBI: 107975
VEGA: 19
Homologene: 9970
Genetic Alterations

LSL-huPacs1-exon4 R201W conditional knock-in mice carry a humanized exon 4 with the R201W amino acid substitution preceded by a lox-STOP-lox (LSL) cassette in the Pacs1 (phosphofurin acidic cluster sorting protein 1) gene. This strain may be useful for research in neurodevelopmental disorders such as PACS1 syndrome.


Genotype Determination
ES Cell Line
Not applicable
Phenotype
The Pacs1 (phosphofurin acidic cluster sorting protein 1) gene encodes a trans-Golgi-membrane traffic regulator that directs protein cargo and is upregulated during embryonic brain development with low expression after birth. A human missense mutation in PACS1, R203W, is associated with developmental delay and intellectual disability (PACS1 syndrome). Functionally, the mutation results in increased dendrite arborization, diminished spine density, and fewer functional synapses.

LSL-huPacs1-exon4 R201W conditional knock-in mice carry a CRISPR/Cas9 generated insertion of a humanized exon 4 with the R201W amino acid substitution preceded by a lox-STOP-lox (LSL) cassette in the Pacs1 gene. The mutation is orthologous to the human R203W mutation. The LSL cassette prevents expression of Pacs1 until the cassette is removed by cre-mediated recombination of the loxP sites. Upon recombination, normal transcription resumes into the humanized exon 4 with R201W disease variant. Prior to recombination, homozygous mice are born below expected Mendelian ratios (11.7% of the expected 25% in het x het crosses) but appear healthy and are fertile. mRNA expression of homozygous brain tissue by qRTPCR was unable to detect Pacs1 expression in brain tissue of homozygous LSL mice, with reduced expression in heterozygous mice.

When heterozygous LSL males are bred with B6.129S2-Emx1tm1(cre)Krj/J female mice, which express cre in neurons of the neocortex, hippocampus, and glial cells of the pallium, the resulting recombinant mice are born at Mendelian ratios and appear healthy. In recombined mice, mRNA expression of heterozygous brain tissue by qRTPCR showed expression of the humanized exon 4 with the R201W variant.


Strain Development
The LSL-huPacs1-exon4 R201W allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CCAGAGGGCCTGGTACTGCA,AGAAAGAAAGAAATGCCAGA,GGGCTATAAAACCTTAGCTG, and GGCTATAAAACCTTAGCTGT) were selected to excise and replace murine exon 4 of the Pacs1 (phosphofurin acidic cluster sorting protein 1) gene on chromosome 19 containing a human exon 4 with the R201W (CGG to TGG, arginine to tryptophan, c.601) variant. A loxP-flanked STOP cassette, which contains a splice acceptor and 3x SV40 polyadenylation sequence was inserted into intron 3/4. Mouse Pcs1 transcript Pac1-201 (ENSMUST00000025786.9) and human PACS1-201 (ENST00000320580.9) were used as reference for the exon number and guide sequences. The guides and double strand plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J (Stock No. 000664) mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071615-JAX-HOM-F
071615-JAX-HOM-M
Homozygous Female
Homozygous Male
$218.00 / $218.00
Non-Profit / For-Profit
Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
071615-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.