Strain Name:
C57BL/6J-MtgxR0990Btlr/Mmmh
Stock Number:
039110-MU
Citation ID:
RRID:MMRRC_039110-MU
Other Names:
R0990 (G1), C57BL/6J-MtgxR0990Btlr
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Gm4392, Ankyrin-B, Ank-2, Ankyrin-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Arhgef12
Name: Rho guanine nucleotide exchange factor 12
Synonyms: 2310014B11Rik, LARG
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69632
VEGA: 9
Homologene: 9088
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Smad1
Name: SMAD family member 1
Synonyms: Smad 1, Madr1, Madh1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17125
HGNC: HGNC:6767
Homologene: 21196
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pkm2, Pk-3, Pk-2, Pk3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Setdb1
Name: SET domain, bifurcated 1
Synonyms: ESET, KMT1E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84505
Homologene: 32157
Arhgap32
Name: Rho GTPase activating protein 32
Synonyms: p200RhoGAP, PX-RICS, 3426406O18Rik, Grit, GC-GAP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330914
Homologene: 8812
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Cog8
Name: component of oligomeric golgi complex 8
Synonyms: C87832
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97484
Homologene: 13018
Sgk1
Name: serum/glucocorticoid regulated kinase 1
Synonyms: Sgk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20393
Homologene: 48364
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Satb2
Name: special AT-rich sequence binding protein 2
Synonyms: BAP002
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212712
Homologene: 32249
Fam120a
Name: family with sequence similarity 120, member A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218236
VEGA: 13
Homologene: 8752
Pdk4
Name: pyruvate dehydrogenase kinase, isoenzyme 4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27273
HGNC: HGNC:8812
Homologene: 129720
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Fbxo24
Name: F-box protein 24
Synonyms: Fbx24, 4933422D21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71176
Homologene: 14131
Mettl2
Name: methyltransferase 2, methylcytidine
Synonyms: 2810438F06Rik, PSENIP1, D11Ertd768e, C130031G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52686
Homologene: 10174
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Gm9938
Name: predicted gene 9938
Type: Gene
Species: Mouse
Chromosome: 19
Vmn2r53
Name: vomeronasal 2, receptor 53
Synonyms: EG637908
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637908
Homologene: 104040
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Slc22a23
Name: solute carrier family 22, member 23
Synonyms: 3110004L20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73102
Homologene: 41457
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Tgm4
Name: transglutaminase 4 (prostate)
Synonyms: 9530008N10Rik, experimental autoimmune prostatitis antigen 1, Eapa1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331046
Homologene: 20689
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Scart1
Name: scavenger receptor family member expressed on T cells 1
Synonyms: E430002D04Rik, Cd163l1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244233
Homologene: 129778
Marchf3
Name: membrane associated ring-CH-type finger 3
Synonyms: March3, A530081L18Rik, 6330411I15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 320253
Homologene: 35310
Or5aq1
Name: olfactory receptor family 5 subfamily AQ member 1
Synonyms: Olfr1110, GA_x6K02T2Q125-48621299-48620361, MOR172-4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258765
4933407P14Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 56,850,184 bp
  • A to G, chromosome 1 at 74,921,519 bp
  • A to G, chromosome 1 at 185,318,627 bp
  • T to A, chromosome 2 at 87,135,742 bp
  • A to T, chromosome 3 at 90,211,925 bp
  • T to C, chromosome 3 at 95,340,265 bp
  • T to C, chromosome 3 at 126,934,666 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • T to C, chromosome 5 at 137,618,439 bp
  • A to T, chromosome 6 at 5,485,577 bp
  • A to G, chromosome 7 at 12,581,502 bp
  • A to G, chromosome 7 at 140,228,441 bp
  • T to A, chromosome 8 at 79,343,788 bp
  • T to C, chromosome 8 at 88,325,452 bp
  • G to A, chromosome 8 at 105,359,446 bp
  • T to A, chromosome 8 at 107,052,487 bp
  • A to G, chromosome 9 at 32,255,381 bp
  • T to C, chromosome 9 at 42,972,381 bp
  • A to G, chromosome 9 at 59,678,096 bp
  • A to G, chromosome 9 at 123,046,511 bp
  • T to C, chromosome 10 at 21,997,086 bp
  • C to T, chromosome 11 at 104,190,712 bp
  • T to A, chromosome 11 at 105,137,744 bp
  • T to C, chromosome 12 at 85,267,765 bp
  • A to T, chromosome 13 at 34,195,467 bp
  • G to T, chromosome 13 at 48,885,743 bp
  • G to A, chromosome 14 at 103,581,832 bp
  • A to G, chromosome 16 at 32,752,722 bp
  • A to T, chromosome 18 at 56,807,798 bp
  • A to G, chromosome 19 at 23,724,592 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0990 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039110-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.