Strain Name:
C57BL/6J-MtgxR5083Btlr/Mmmh
Stock Number:
042672-MU
Citation ID:
RRID:MMRRC_042672-MU
Other Names:
R5083 (G1), C57BL/6J-MtgxR5083Btlr
Major Collection:

Strain Information

Comp
Name: cartilage oligomeric matrix protein
Synonyms: TSP5, thrombospondin-5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12845
HGNC: HGNC:2227
Homologene: 74
Suclg1
Name: succinate-CoA ligase, GDP-forming, alpha subunit
Synonyms: Sucla1, 1500000I01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56451
Homologene: 55785
Kdm3a
Name: lysine (K)-specific demethylase 3A
Synonyms: Jmjd1a, Jmjd1, Tsga, C230043E16Rik, 1700105C21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 104263
Homologene: 10196
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, 9030205D12Rik, A330063D19Rik, AD013
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Ddx39b
Name: DEAD box helicase 39b
Synonyms: Bat1, D17H6S81E-1, Bat-1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B, 0610030D10Rik, Bat1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53817
Homologene: 48376
Esf1
Name: ESF1 nucleolar pre-rRNA processing protein homolog
Synonyms: 2610101J03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66580
Homologene: 5717
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: 9330189K18Rik, B230217J03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Ints12
Name: integrator complex subunit 12
Synonyms: Phf22, 1110020M19Rik, 2810027J24Rik, 4930529N21Rik, A230056J18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71793
Homologene: 32474
Fcho1
Name: FCH domain only 1
Synonyms: 3322402E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74015
Homologene: 22869
Bet1
Name: Bet1 golgi vesicular membrane trafficking protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12068
Homologene: 38108
Jak3
Name: Janus kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16453
HGNC: HGNC:6193
Homologene: 181
Ppa1
Name: pyrophosphatase (inorganic) 1
Synonyms: Pyp, 2010317E03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67895
HGNC: HGNC:9226
Homologene: 5356
Cdc23
Name: CDC23 cell division cycle 23
Synonyms: D18Ertd243e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52563
HGNC: HGNC:1724
Homologene: 3426
Myo19
Name: myosin XIX
Synonyms: 1110055A02Rik, Myohd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66196
Homologene: 49819
Sdccag8
Name: serologically defined colon cancer antigen 8
Synonyms: 5730470G24Rik, 2700048G21Rik, CCCAP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76816
Homologene: 4839
Esco1
Name: establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms: A930014I12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77805
Homologene: 62166
Atp2a3
Name: ATPase, Ca++ transporting, ubiquitous
Synonyms: Serca3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53313
HGNC: HGNC:813
Homologene: 69131
Invs
Name: inversin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16348
Homologene: 7786
Pdcd2
Name: programmed cell death 2
Synonyms: RP-8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18567
HGNC: HGNC:8762
Homologene: 1951
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Mroh7
Name: maestro heat-like repeat family member 7
Synonyms: Gm1027, Heatr8, LOC381538
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381538
Homologene: 19633
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, D430003I15Rik, Abc10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Foxn4
Name: forkhead box N4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116810
Homologene: 17526
Nalcn
Name: sodium leak channel, non-selective
Synonyms: Vgcnl1, A530023G15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242259
Homologene: 72094
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: Adlican2, CMF608, 6530405F15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Mgat3
Name: mannoside acetylglucosaminyltransferase 3
Synonyms: GnT-III, 1110038J12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17309
VEGA: 15
HGNC: HGNC:7046
Homologene: 31088
Myo15b
Name: myosin XVB
Synonyms: LOC380737, E330039G21Rik, LOC217328
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Mypn
Name: myopalladin
Synonyms: 1110056A04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68802
VEGA: 10
Homologene: 23778
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: B230104L07Rik, GluRdelta2, tpr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Chil3
Name: chitinase-like 3
Synonyms: Chi3l3, Ym1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12655
Homologene: 74931
Plagl2
Name: pleiomorphic adenoma gene-like 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54711
HGNC: HGNC:9047
Homologene: 1994
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Dctd
Name: dCMP deaminase
Synonyms: 6030466N05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320685
HGNC: HGNC:2710
Homologene: 55618
A530064D06Rik
Name: RIKEN cDNA A530064D06 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328830
VEGA: 17
Homologene: 136361
Vps33b
Name: vacuolar protein sorting 33B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233405
Homologene: 10261
Vmn2r28
Name: vomeronasal 2, receptor 28
Synonyms: EG665255
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665255
Homologene: 129605
Or8c10
Name: olfactory receptor family 8 subfamily C member 10
Synonyms: MOR170-14, MOR170-8, GA_x6K02T2PVTD-32060891-32061865, Olfr899, Olfr250, GA_x6K02T2MYUG-19447-18473
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404312
VEGA: 9
Homologene: 74151
Agbl5
Name: ATP/GTP binding protein-like 5
Synonyms: 9430057O19Rik, Ccp5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231093
Homologene: 11053
Ergic2
Name: ERGIC and golgi 2
Synonyms: 4930572C01Rik, 1200009B18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67456
Homologene: 6574
Epx
Name: eosinophil peroxidase
Synonyms: EPO
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13861
HGNC: HGNC:3423
Homologene: 20144
Skint1
Name: selection and upkeep of intraepithelial T cells 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639781
Homologene: 87538
Mrgprb3
Name: MAS-related GPR, member B3
Synonyms: MrgB3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404238
Homologene: 138632
Krtap9-21
Name: keratin associated protein 9-21
Synonyms: Gm11568
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432600
Dtx2
Name: deltex 2, E3 ubiquitin ligase
Synonyms: 2610524D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74198
Homologene: 56904
Or2a52
Name: olfactory receptor family 2 subfamily A member 52
Synonyms: Olfr437, MOR261-11, GA_x6K02T2P3E9-4391088-4390156
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258293
HGNC: HGNC:8230
Homologene: 122778
4930433N12Rik
Name: RIKEN cDNA 4930433N12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 114673
Or52e7
Name: olfactory receptor family 52 subfamily E member 7
Synonyms: Olfr676, GA_x6K02T2PBJ9-7664016-7664969, MOR32-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259099
Homologene: 64955
Zfp1010
Name: zinc finger protein 1010
Synonyms: Gm14409
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 115489547
4930523C07Rik
Name: RIKEN cDNA 4930523C07 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67647
Homologene: 124386
Eif6
Name: eukaryotic translation initiation factor 6
Synonyms: eIF6, p27BBP, Itgb4bp, imc-415
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16418
HGNC: HGNC:6159
Homologene: 7135
Gm26773
Name: predicted gene, 26773
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Btnl5-ps
Name: butyrophilin-like 5, pseudogene
Synonyms: Btnl5, ENSMUSG00000073420, NG12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81497
RP24-527P22.4
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Gm15592
Name: predicted gene 15592
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 74,906,441 bp
  • A to T, chromosome 1 at 160,077,360 bp
  • C to A, chromosome 1 at 176,824,892 bp
  • T to C, chromosome 2 at 76,813,533 bp
  • T to C, chromosome 2 at 76,870,737 bp
  • G to T, chromosome 2 at 140,157,071 bp
  • T to C, chromosome 2 at 140,158,579 bp
  • T to C, chromosome 2 at 153,236,044 bp
  • A to T, chromosome 2 at 155,826,198 bp
  • A to G, chromosome 2 at 177,265,571 bp
  • A to G, chromosome 3 at 59,326,273 bp
  • C to A, chromosome 3 at 106,164,089 bp
  • A to G, chromosome 3 at 122,170,074 bp
  • T to C, chromosome 3 at 133,100,777 bp
  • A to T, chromosome 3 at 154,247,787 bp
  • A to T, chromosome 3 at 154,247,789 bp
  • A to T, chromosome 4 at 48,396,307 bp
  • A to T, chromosome 4 at 106,690,318 bp
  • A to G, chromosome 4 at 112,029,433 bp
  • G to A, chromosome 5 at 30,903,059 bp
  • T to A, chromosome 5 at 114,256,927 bp
  • T to C, chromosome 5 at 136,012,190 bp
  • T to C, chromosome 6 at 4,077,895 bp
  • T to A, chromosome 6 at 18,270,361 bp
  • G to T, chromosome 6 at 43,167,339 bp
  • C to T, chromosome 6 at 64,320,152 bp
  • T to C, chromosome 6 at 71,621,362 bp
  • C to A, chromosome 6 at 73,263,980 bp
  • T to C, chromosome 6 at 148,196,014 bp
  • A to T, chromosome 7 at 5,480,672 bp
  • A to T, chromosome 7 at 10,159,465 bp
  • A to G, chromosome 7 at 48,643,014 bp
  • G to T, chromosome 7 at 80,274,641 bp
  • A to T, chromosome 7 at 105,035,411 bp
  • A to T, chromosome 7 at 116,342,401 bp
  • T to C, chromosome 8 at 48,111,716 bp
  • C to T, chromosome 8 at 70,381,300 bp
  • T to C, chromosome 8 at 71,680,097 bp
  • C to A, chromosome 8 at 71,717,176 bp
  • T to C, chromosome 8 at 90,984,374 bp
  • T to A, chromosome 9 at 3,133,881 bp
  • G to A, chromosome 9 at 38,368,062 bp
  • T to A, chromosome 10 at 52,163,941 bp
  • CTAATTAATTAATTAATTAATTAATTAATT to CTAATTAATTAATTAATTAATTAATT, chromosome 10 at 61,651,657 bp
  • A to T, chromosome 10 at 63,118,528 bp
  • G to T, chromosome 11 at 72,982,826 bp
  • G to T, chromosome 11 at 84,903,211 bp
  • A to G, chromosome 11 at 87,872,680 bp
  • T to C, chromosome 11 at 99,857,972 bp
  • T to C, chromosome 11 at 110,218,967 bp
  • A to T, chromosome 11 at 115,866,656 bp
  • T to A, chromosome 12 at 78,623,289 bp
  • C to A, chromosome 14 at 118,116,079 bp
  • A to G, chromosome 14 at 123,323,294 bp
  • G to A, chromosome 15 at 80,211,298 bp
  • A to G, chromosome 17 at 5,314,018 bp
  • A to G, chromosome 17 at 15,522,822 bp
  • A to G, chromosome 17 at 34,492,492 bp
  • G to A, chromosome 17 at 35,253,029 bp
  • C to T, chromosome 17 at 48,166,390 bp
  • A to G, chromosome 18 at 10,594,734 bp
  • C to A, chromosome 18 at 34,651,689 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5083 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042672-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.