Strain Name:
C57BL/6J-MtgxR5347Btlr/Mmmh
Stock Number:
042926-MU
Citation ID:
RRID:MMRRC_042926-MU
Other Names:
R5347 (G1), C57BL/6J-MtgxR5347Btlr
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Acvr2a
Name: activin receptor IIA
Synonyms: ActRIIa, tActRII, Acvr2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11480
HGNC: HGNC:173
Homologene: 20391
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Fbxl3
Name: F-box and leucine-rich repeat protein 3
Synonyms: Fbl3a, Fbxl3a, Ovtm, Play68
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50789
Homologene: 8127
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Tcf12
Name: transcription factor 12
Synonyms: ME1, ALF1, HEB, HTF4, HTF-4, REB, bHLHb20, HEBAlt
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21406
Homologene: 40774
Tcf3
Name: transcription factor 3
Synonyms: ALF2, E2A, E47, E12, Pan2, Pan1, A1, Tcfe2a, bHLHb21
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21423
Homologene: 2408
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Trpc4ap
Name: transient receptor potential cation channel, subfamily C, member 4 associated protein
Synonyms: Trp4-associated protein TAP1, Trrp4ap, D2Ertd113e, 4833429F06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56407
Homologene: 9224
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Set
Name: SET nuclear oncogene
Synonyms: StF-IT-1, 2610030F17Rik, 5730420M11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56086
Homologene: 55707
Fto
Name: FTO alpha-ketoglutarate dependent dioxygenase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26383
Homologene: 8053
Esf1
Name: ESF1 nucleolar pre-rRNA processing protein homolog
Synonyms: 2610101J03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66580
Homologene: 5717
Nrf1
Name: nuclear respiratory factor 1
Synonyms: D6Ertd415e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18181
HGNC: HGNC:7996
Homologene: 3674
Xdh
Name: xanthine dehydrogenase
Synonyms: Xox-1, Xox1, Xor, xanthine oxidase, XO
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22436
VEGA: 17
Homologene: 324
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: B230217J03Rik, 9330189K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Utp25
Name: UTP25 small subunit processome component
Synonyms: AA408296, Diexf, mDef
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215193
Homologene: 6170
Cdan1
Name: codanin 1
Synonyms: CDA-I, CDA1, 1500015A01Rik, codanin-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68968
HGNC: HGNC:1713
Homologene: 16324
Zfy1
Name: zinc finger protein 1, Y-linked
Synonyms: Zfy-1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22767
Homologene: 56456
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Edem3
Name: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: 2310050N11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66967
Homologene: 11866
Necap1
Name: NECAP endocytosis associated 1
Synonyms: 1200016B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67602
Homologene: 22902
Dnaja3
Name: DnaJ heat shock protein family (Hsp40) member A3
Synonyms: Tid-1, 1200003J13Rik, 1810053A11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 83945
Homologene: 36170
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, Plekhm1l, 9430067K14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Sp8
Name: trans-acting transcription factor 8
Synonyms: mBtd, D930049B17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320145
VEGA: 12
Homologene: 18548
Grk1
Name: G protein-coupled receptor kinase 1
Synonyms: RK, Rhok
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24013
Homologene: 2197
Tub
Name: TUB bipartite transcription factor
Synonyms: rd5, tub
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22141
Homologene: 31147
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Nr3c2
Name: nuclear receptor subfamily 3, group C, member 2
Synonyms: aldosterone receptor, Mlr, MR, mineralocorticoid receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110784
HGNC: HGNC:7979
Homologene: 121495
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232854
Homologene: 119890
Fhip2a
Name: FHF complex subunit HOOK interacting protein 2A
Synonyms: Fam160b1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226252
VEGA: 19
Homologene: 28133
Sbk3
Name: SH3 domain binding kinase family, member 3
Synonyms: LOC381835, Gm1078
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381835
Homologene: 82595
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Slco1a6
Name: solute carrier organic anion transporter family, member 1a6
Synonyms: organic anion-transporting polypeptide, Oatp-5, 4930422F19Rik, Slc21a13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28254
Homologene: 23416
Agl
Name: amylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms: 9430004C13Rik, 9630046L06Rik, 1110061O17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77559
HGNC: HGNC:321
Homologene: 536
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Eif2b1
Name: eukaryotic translation initiation factor 2B, subunit alpha
Synonyms: EIF2BA, EIF2B, 26kDa, D5Ertd406e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209354
HGNC: HGNC:3257
Homologene: 1080
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244650
Homologene: 71015
Mbl1
Name: mannose-binding lectin (protein A) 1
Synonyms: MBL-A, MBP-A
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17194
VEGA: 14
HGNC: HGNC:6921
Homologene: 55449
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Krt24
Name: keratin 24
Synonyms: 2310075C18Rik, 2310058N18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75706
Homologene: 10379
Wdhd1
Name: WD repeat and HMG-box DNA binding protein 1
Synonyms: AND-1, D630024B06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218973
Homologene: 56019
Lnpk
Name: lunapark, ER junction formation factor
Synonyms: 2310011O18Rik, 4921514L11Rik, 9530051D01Rik, lunapark, Lnpk1, Lnp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69605
Homologene: 12319
Gm5773
Name: predicted pseudogene 5773
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 436563
Serpinb9e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9e
Synonyms: ovalbumin, Spi14, NK26
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20710
HGNC: HGNC:8955
Homologene: 69093
Cdh15
Name: cadherin 15
Synonyms: Cdh14, Mcad, M cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Cnnm1
Name: cyclin M1
Synonyms: Acdp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83674
VEGA: 19
HGNC: HGNC:102
Homologene: 10673
Itgax
Name: integrin alpha X
Synonyms: CD11C (p150) alpha polypeptide, Cd11c, CR4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16411
HGNC: HGNC:6152
Homologene: 55493
Pcare
Name: photoreceptor cilium actin regulator
Synonyms: BC027072
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225004
VEGA: 17
Homologene: 19792
Gpam
Name: glycerol-3-phosphate acyltransferase, mitochondrial
Synonyms: GPAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14732
Homologene: 7343
Zfpm1
Name: zinc finger protein, multitype 1
Synonyms: Friend of GATA-1, Fog1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22761
Homologene: 7606
Lrrc56
Name: leucine rich repeat containing 56
Synonyms: 5730427C23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70552
Homologene: 115748
Mmp21
Name: matrix metallopeptidase 21
Synonyms: b2b873Clo, b2b2458Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214766
Homologene: 17519
Bend7
Name: BEN domain containing 7
Synonyms: 1110017O21Rik, E130319B15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209645
Homologene: 17660
Bbs2
Name: Bardet-Biedl syndrome 2
Synonyms: 2410125H22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67378
HGNC: HGNC:967
Homologene: 12122
Cplx4
Name: complexin 4
Synonyms: A930004D23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225644
VEGA: 18
Homologene: 17150
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: NKT, Oat1, Orctl1, mOat1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Slc17a4
Name: solute carrier family 17 (sodium phosphate), member 4
Synonyms: 9130214H05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319848
Homologene: 21127
Ccdc169
Name: coiled-coil domain containing 169
Synonyms: A730037C10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320604
Homologene: 77607
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Ndufa11b
Name: NADH:ubiquinone oxidoreductase subunit A11B
Synonyms: Gm4943
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239760
Homologene: 17926
Ighv1-23
Name: immunoglobulin heavy variable V1-23
Synonyms: immunoglobulin heavy variable V1-23, Ighv1-23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780884
HGNC: HGNC:5553
Gm5916
Name: predicted gene 5916
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546123
CR974439.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Mrgpra14
Name: MAS-related GPR, member A14
Synonyms: MrgA14, Gm9717
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 677457
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 44,057,795 bp
  • T to C, chromosome 1 at 64,819,990 bp
  • C to T, chromosome 1 at 139,337,371 bp
  • A to G, chromosome 1 at 151,807,451 bp
  • A to G, chromosome 1 at 162,713,382 bp
  • A to T, chromosome 1 at 193,128,379 bp
  • G to A, chromosome 2 at 4,763,241 bp
  • T to A, chromosome 2 at 30,069,410 bp
  • G to A, chromosome 2 at 35,037,624 bp
  • A to G, chromosome 2 at 48,892,154 bp
  • T to C, chromosome 2 at 74,573,591 bp
  • A to G, chromosome 2 at 120,730,065 bp
  • T to A, chromosome 2 at 140,154,881 bp
  • A to G, chromosome 2 at 155,672,988 bp
  • A to T, chromosome 3 at 55,142,319 bp
  • A to C, chromosome 3 at 56,040,876 bp
  • T to C, chromosome 3 at 93,773,783 bp
  • A to G, chromosome 3 at 116,791,165 bp
  • T to A, chromosome 4 at 141,471,485 bp
  • T to C, chromosome 5 at 121,304,448 bp
  • T to C, chromosome 5 at 124,578,799 bp
  • C to T, chromosome 6 at 30,118,968 bp
  • T to G, chromosome 6 at 122,081,592 bp
  • A to G, chromosome 6 at 122,880,747 bp
  • A to G, chromosome 6 at 142,086,599 bp
  • A to T, chromosome 7 at 4,967,423 bp
  • A to C, chromosome 7 at 7,182,535 bp
  • G to T, chromosome 7 at 47,556,167 bp
  • A to G, chromosome 7 at 55,823,685 bp
  • G to T, chromosome 7 at 109,026,771 bp
  • G to A, chromosome 7 at 128,141,302 bp
  • T to C, chromosome 7 at 133,675,922 bp
  • A to G, chromosome 7 at 141,209,624 bp
  • G to A, chromosome 8 at 13,414,478 bp
  • T to A, chromosome 8 at 77,210,748 bp
  • A to G, chromosome 8 at 91,391,479 bp
  • A to G, chromosome 8 at 94,092,550 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 109,904,456 bp
  • G to A, chromosome 8 at 122,335,530 bp
  • A to G, chromosome 8 at 122,862,063 bp
  • T to G, chromosome 9 at 7,129,727 bp
  • A to T, chromosome 9 at 36,120,716 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • G to A, chromosome 9 at 71,885,243 bp
  • A to G, chromosome 9 at 75,295,205 bp
  • A to G, chromosome 9 at 107,514,114 bp
  • A to G, chromosome 10 at 80,410,211 bp
  • T to A, chromosome 11 at 99,282,730 bp
  • T to C, chromosome 12 at 114,764,756 bp
  • A to G, chromosome 12 at 118,848,511 bp
  • C to T, chromosome 13 at 23,908,817 bp
  • T to C, chromosome 13 at 33,257,784 bp
  • A to T, chromosome 14 at 41,158,829 bp
  • A to T, chromosome 14 at 47,268,724 bp
  • A to C, chromosome 14 at 103,083,294 bp
  • T to A, chromosome 16 at 4,694,482 bp
  • G to A, chromosome 16 at 22,053,660 bp
  • A to G, chromosome 16 at 94,267,524 bp
  • T to A, chromosome 16 at 94,429,620 bp
  • C to T, chromosome 17 at 5,291,057 bp
  • T to C, chromosome 17 at 37,574,727 bp
  • A to G, chromosome 17 at 71,749,935 bp
  • T to A, chromosome 17 at 73,925,032 bp
  • G to A, chromosome 18 at 65,970,086 bp
  • G to T, chromosome 18 at 77,366,541 bp
  • T to A, chromosome 19 at 8,618,553 bp
  • A to G, chromosome 19 at 43,441,862 bp
  • A to T, chromosome 19 at 55,088,837 bp
  • A to G, chromosome 19 at 57,378,619 bp
  • T to C, chromosome Y at 725,950 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5347 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042926-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.