Strain Name:
C57BL/6J-MtgxR5798Btlr/Mmmh
Stock Number:
043210-MU
Citation ID:
RRID:MMRRC_043210-MU
Other Names:
R5798 (G1), C57BL/6J-MtgxR5798Btlr
Major Collection:

Strain Information

Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Ankle2
Name: ankyrin repeat and LEM domain containing 2
Synonyms: 1110001J12Rik, D5Ertd585e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71782
Homologene: 35424
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 3526402J09Rik, 5730590C14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Gnaz
Name: guanine nucleotide binding protein, alpha z subunit
Synonyms: Gz
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14687
HGNC: HGNC:4395
Homologene: 22574
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: XCE, DINE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Rfx2
Name: regulatory factor X, 2 (influences HLA class II expression)
Synonyms: 5430432H19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19725
VEGA: 17
HGNC: HGNC:9983
Homologene: 30980
Homer1
Name: homer scaffolding protein 1
Synonyms: PSD-Zip45, Ves-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26556
Homologene: 3155
Zfp148
Name: zinc finger protein 148
Synonyms: ZBP-89, BFCOL1, BERF-1, 2210405J08Rik, beta enolase repressor factor 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22661
VEGA: 16
Homologene: 8003
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 4632412F08Rik, 5330435L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Ankrd52
Name: ankyrin repeat domain 52
Synonyms: G431002C21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237615
Homologene: 18227
Or14j10
Name: olfactory receptor family 14 subfamily J member 10
Synonyms: GA_x6K02T2PSCP-2084102-2083137, MOR218-2, Olfr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258625
Slc39a12
Name: solute carrier family 39 (zinc transporter), member 12
Synonyms: LOC277468
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277468
Homologene: 17654
Vmn2r56
Name: vomeronasal 2, receptor 56
Synonyms: EG629079
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 629079
Homologene: 104040
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Vmn2r108
Name: vomeronasal 2, receptor 108
Synonyms: EG627805
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627805
Homologene: 129678
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Arhgef40
Name: Rho guanine nucleotide exchange factor 40
Synonyms: E130112L23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268739
Homologene: 19560
Ces3b
Name: carboxylesterase 3B
Synonyms: Gm4738, ES31L
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13909
HGNC: HGNC:1865
Homologene: 84407
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Or52e7
Name: olfactory receptor family 52 subfamily E member 7
Synonyms: Olfr676, GA_x6K02T2PBJ9-7664016-7664969, MOR32-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259099
Homologene: 64955
Timd2
Name: T cell immunoglobulin and mucin domain containing 2
Synonyms: TIM-2, Tim2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171284
Homologene: 82236
Ccdc169
Name: coiled-coil domain containing 169
Synonyms: A730037C10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320604
Homologene: 77607
1700010K23Rik
Name: RIKEN cDNA 1700010K23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 75501
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 87,151,483 bp
  • G to A, chromosome 2 at 14,449,826 bp
  • A to G, chromosome 2 at 168,690,964 bp
  • T to C, chromosome 3 at 55,140,124 bp
  • G to A, chromosome 4 at 134,091,179 bp
  • TCTGAGCTGCTGAGCTGC to TCTGAGCTGC, chromosome 4 at 141,041,807 bp
  • A to G, chromosome 5 at 110,251,535 bp
  • T to C, chromosome 7 at 12,712,965 bp
  • A to C, chromosome 7 at 105,036,137 bp
  • T to A, chromosome 8 at 105,088,440 bp
  • A to G, chromosome 9 at 75,284,198 bp
  • C to T, chromosome 10 at 75,014,871 bp
  • T to A, chromosome 10 at 128,387,610 bp
  • T to C, chromosome 11 at 46,677,237 bp
  • TGCAGCAGCAGCAGCAGCAGCAGC to TGCAGCAGCAGCAGCAGCAGC, chromosome 11 at 105,921,855 bp
  • C to T, chromosome 11 at 106,695,832 bp
  • G to A, chromosome 11 at 113,827,116 bp
  • C to A, chromosome 13 at 93,402,095 bp
  • G to T, chromosome 14 at 51,997,032 bp
  • T to C, chromosome 16 at 33,496,143 bp
  • A to G, chromosome 16 at 66,664,546 bp
  • A to T, chromosome 17 at 20,472,283 bp
  • A to G, chromosome 17 at 37,623,990 bp
  • A to T, chromosome 17 at 46,306,003 bp
  • A to T, chromosome 17 at 56,804,362 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5798 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043210-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.