Loading Mouse GIF
Loading...

Strain Name:
C57BL/6NJ-Pgpep1em1(IMPC)J/Mmjax
Stock Number:
068281-JAX
Citation ID:
RRID:MMRRC_068281-JAX
Major Collection:

Strain Information

Pgpep1em1(IMPC)J
Name: pyroglutamyl-peptidase I; endonuclease-mediated mutation 1, Jackson
Type: Allele
Species: Mus musculus
Chromosome:
Alteration at locus: CRISPR
Pgpep1
Name: pyroglutamyl-peptidase I
Synonyms: PGP-I, Pcp, 2810003H13Rik
Type: Gene
Species: Mus musculus
Chromosome: 8
Alteration at locus: CRISPR
NCBI: 66522
Homologene: 9793
Genetic Alterations
intragenic deletion
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain Development
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTAGTGTGGACCATAGCG and TCCAGGCGTGTGATTCTTGG, which resulted in a 13601 bp deletion beginning at Chromosome 8 position 70,646,368 bp and ending after 70,659,968 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349254, ENSMUSE00000213761, ENSMUSE00000213760, ENSMUSE00000437318 and ENSMUSE00000437329 (exons 1-5) and 8718 bp of intronic sequence including the start site, splice acceptor and donor as well as 3 UTR and is predicted to result in a null allele.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
black
Generation
N2F2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined
Heterozygotes are fertile: Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text