Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0142Btlr/Mmmh
Stock Number:
038427-MU
Citation ID:
RRID:MMRRC_038427-MU
Other Names:
R0142 (G1), C57BL/6J-MtgxR0142Btlr
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Hdgf
Name: heparin binding growth factor
Synonyms: D3Ertd299e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15191
HGNC: HGNC:4856
Homologene: 3306
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Dnajc17
Name: DnaJ heat shock protein family (Hsp40) member C17
Synonyms: D9Bwg1371e, 1700025B16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69408
Homologene: 49527
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 55935
Homologene: 9087
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 38,871,729 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • A to T, chromosome 1 at 178,915,389 bp
  • A to C, chromosome 1 at 188,996,398 bp
  • G to A, chromosome 2 at 18,683,284 bp
  • A to G, chromosome 2 at 55,098,603 bp
  • T to A, chromosome 2 at 90,746,802 bp
  • C to A, chromosome 2 at 119,179,934 bp
  • A to T, chromosome 3 at 64,492,588 bp
  • G to A, chromosome 3 at 87,913,109 bp
  • G to A, chromosome 3 at 90,172,113 bp
  • C to A, chromosome 4 at 11,548,783 bp
  • A to G, chromosome 4 at 58,118,232 bp
  • A to C, chromosome 4 at 117,905,569 bp
  • T to G, chromosome 4 at 126,516,932 bp
  • A to G, chromosome 4 at 128,585,837 bp
  • A to T, chromosome 4 at 133,250,946 bp
  • T to A, chromosome 4 at 136,327,282 bp
  • A to G, chromosome 5 at 8,088,077 bp
  • T to C, chromosome 5 at 23,527,930 bp
  • A to G, chromosome 5 at 30,913,920 bp
  • G to A, chromosome 5 at 65,143,350 bp
  • A to G, chromosome 5 at 111,277,457 bp
  • A to T, chromosome 5 at 112,915,053 bp
  • A to T, chromosome 5 at 118,056,570 bp
  • C to T, chromosome 5 at 135,180,607 bp
  • A to T, chromosome 5 at 149,188,349 bp
  • A to G, chromosome 6 at 12,418,335 bp
  • G to T, chromosome 6 at 118,603,882 bp
  • T to C, chromosome 6 at 119,348,842 bp
  • A to G, chromosome 6 at 140,007,697 bp
  • C to T, chromosome 7 at 5,196,373 bp
  • G to A, chromosome 7 at 6,962,335 bp
  • T to C, chromosome 7 at 81,473,080 bp
  • T to A, chromosome 7 at 81,559,935 bp
  • G to T, chromosome 7 at 106,741,765 bp
  • C to A, chromosome 7 at 107,744,177 bp
  • T to A, chromosome 8 at 10,569,790 bp
  • G to A, chromosome 8 at 13,477,040 bp
  • A to C, chromosome 8 at 71,461,862 bp
  • A to T, chromosome 8 at 84,721,686 bp
  • A to T, chromosome 8 at 87,780,340 bp
  • C to T, chromosome 8 at 109,907,513 bp
  • A to G, chromosome 8 at 121,753,371 bp
  • A to T, chromosome 9 at 38,048,110 bp
  • C to T, chromosome 9 at 44,507,112 bp
  • C to T, chromosome 9 at 53,635,050 bp
  • C to T, chromosome 9 at 75,160,574 bp
  • C to A, chromosome 9 at 118,636,586 bp
  • A to G, chromosome 10 at 27,187,845 bp
  • G to A, chromosome 10 at 43,999,063 bp
  • T to C, chromosome 10 at 70,925,370 bp
  • T to C, chromosome 10 at 79,815,175 bp
  • A to G, chromosome 10 at 80,894,378 bp
  • G to A, chromosome 10 at 81,487,597 bp
  • C to A, chromosome 11 at 21,857,444 bp
  • C to T, chromosome 11 at 34,082,418 bp
  • G to A, chromosome 11 at 84,894,603 bp
  • T to C, chromosome 11 at 94,214,597 bp
  • T to G, chromosome 11 at 110,188,641 bp
  • A to G, chromosome 12 at 4,866,234 bp
  • A to G, chromosome 13 at 30,540,942 bp
  • A to C, chromosome 13 at 63,872,506 bp
  • C to T, chromosome 14 at 14,861,560 bp
  • G to T, chromosome 14 at 55,108,326 bp
  • T to C, chromosome 14 at 70,567,135 bp
  • A to T, chromosome 14 at 77,030,799 bp
  • T to C, chromosome 16 at 38,253,006 bp
  • A to C, chromosome 16 at 44,490,241 bp
  • T to A, chromosome 17 at 34,873,528 bp
  • T to A, chromosome 18 at 20,270,481 bp
  • A to T, chromosome 19 at 10,664,612 bp
  • A to T, chromosome 19 at 13,749,255 bp
  • G to T, chromosome 19 at 22,987,916 bp
  • A to G, chromosome 19 at 29,718,254 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0142 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038427-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.