Strain Name:
C57BL/6J-MtgxR0142Btlr/Mmmh
Stock Number:
038427-MU
Citation ID:
RRID:MMRRC_038427-MU
Other Names:
R0142 (G1), C57BL/6J-MtgxR0142Btlr
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94187
Homologene: 9010
Hdgf
Name: heparin binding growth factor
Synonyms: D3Ertd299e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 15191
HGNC: HGNC:4856
Homologene: 3306
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 77595
Homologene: 28122
Dnajc17
Name: DnaJ heat shock protein family (Hsp40) member C17
Synonyms: D9Bwg1371e, 1700025B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69408
Homologene: 49527
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66185
Homologene: 41043
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 55935
Homologene: 9087
Hnrnpr
Name: heterogeneous nuclear ribonucleoprotein R
Synonyms: hnRNPR, 2610003J05Rik, Hnrpr, 2610528B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74326
HGNC: HGNC:5047
Homologene: 4251
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Kctd3
Name: potassium channel tetramerisation domain containing 3
Synonyms: NY-REN-45, E330032J19Rik, 4930438A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226823
Homologene: 9395
Palm
Name: paralemmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18483
VEGA: 10
HGNC: HGNC:8594
Homologene: 1937
Ipo13
Name: importin 13
Synonyms: Kap13, Imp13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230673
Homologene: 40968
Cul5
Name: cullin 5
Synonyms: 4921514I20Rik, C330021I08Rik, C030032G03Rik, VACM-1, 8430423K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75717
HGNC: HGNC:2556
Homologene: 2597
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 83675
Homologene: 12856
Jph4
Name: junctophilin 4
Synonyms: JPHL1, JP-4, 9330157P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319984
Homologene: 13034
Hr
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, ba, rh, rh-bmh, bldy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 15460
HGNC: HGNC:5172
Homologene: 3774
Jph3
Name: junctophilin 3
Synonyms: JP-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 57340
Homologene: 10762
Nfix
Name: nuclear factor I/X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18032
HGNC: HGNC:7788
Homologene: 1872
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 117606
Homologene: 32819
Srpk2
Name: serine/arginine-rich protein specific kinase 2
Synonyms: mSRPK2, WBP6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20817
Homologene: 101663
Bcl7b
Name: B cell CLL/lymphoma 7B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12054
HGNC: HGNC:1005
Homologene: 1290
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22057
Homologene: 31334
Myo19
Name: myosin XIX
Synonyms: 1110055A02Rik, Myohd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66196
Homologene: 49819
Uqcrfs1
Name: ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Synonyms: 4430402G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 66694
Homologene: 4378
Lcp2
Name: lymphocyte cytosolic protein 2
Synonyms: SLP-76, twm, SLP76, m1Khoe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16822
HGNC: HGNC:6529
Homologene: 4065
Chst10
Name: carbohydrate sulfotransferase 10
Synonyms: ST, Hnk-1st
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98388
Homologene: 21013
Abhd8
Name: abhydrolase domain containing 8
Synonyms: 0910001L24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 64296
Homologene: 11188
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Myo16
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244281
Homologene: 34710
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 674895
Homologene: 130947
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64817
Homologene: 23386
Itga9
Name: integrin alpha 9
Synonyms: 2610002H11Rik, D9Ertd428e, 6720458D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Plcz1
Name: phospholipase C, zeta 1
Synonyms: 1700041H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 114875
Homologene: 23815
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: T1 gene, T1, ST2, T1/ST2, Fit-1, DER4, ST2L, St2, St2-rs1, Ly84
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Or8b37
Name: olfactory receptor family 8 subfamily B member 37
Synonyms: GA_x6K02T2PVTD-31726544-31727473, MOR162-11P, MOR162-9P, MOR162-11P, MOR162-13, Olfr1550-ps1, Olfr884
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 257996
Homologene: 79400
Uspl1
Name: ubiquitin specific peptidase like 1
Synonyms: E430026A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231915
Homologene: 4235
9930021J03Rik
Name: RIKEN cDNA 9930021J03 gene
Synonyms: Gm9832
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240613
Homologene: 19046
Gas6
Name: growth arrest specific 6
Synonyms: growth arrest-specific, GAS 6, Gas-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14456
HGNC: HGNC:4168
Homologene: 638
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57775
Homologene: 49641
Zscan20
Name: zinc finger and SCAN domains 20
Synonyms: Zfp31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269585
Homologene: 51463
Wdpcp
Name: WD repeat containing planar cell polarity effector
Synonyms: homoloc-13, AV249152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216560
Homologene: 9299
Vwce
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71768
VEGA: 19
Homologene: 17651
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Vmn2r5
Name: vomeronasal 2, receptor 5
Synonyms: EG667060
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 667060
Klhl5
Name: kelch-like 5
Synonyms: 1300013C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71778
HGNC: HGNC:6356
Homologene: 56736
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Thsd7a
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330267
Homologene: 46582
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244650
Homologene: 71015
Bcl9l
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80288
VEGA: 9
Homologene: 65615
Map3k6
Name: mitogen-activated protein kinase kinase kinase 6
Synonyms: Ask2, MAPKKK6, MEKK6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 53608
HGNC: HGNC:6858
Homologene: 3435
Ago4
Name: argonaute RISC catalytic subunit 4
Synonyms: 5730550L01Rik, argonaute 4, Eif2c4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76850
Homologene: 41184
Or10q1
Name: olfactory receptor family 10 subfamily Q member 1
Synonyms: GA_x6K02T2RE5P-4082427-4083374, MOR266-1, Olfr1494
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258992
Homologene: 64855
Cacna2d4
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms: 5730412N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 319734
Homologene: 26544
Or2ag15
Name: olfactory receptor family 2 subfamily AG member 15
Synonyms: GA_x6K02T2PBJ9-9119301-9118348, MOR283-5, Olfr697
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258592
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269152
Homologene: 18623
Bmi1
Name: Bmi1 polycomb ring finger oncogene
Synonyms: Bmi-1, Bmi1, Pcgf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12151
Homologene: 3797
Galnt13
Name: polypeptide N-acetylgalactosaminyltransferase 13
Synonyms: pp-GalNAc-T13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271786
Homologene: 62167
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Emilin1
Name: elastin microfibril interfacer 1
Synonyms: 5830419M17Rik, gp115, EMILIN-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100952
Homologene: 5117
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 209683
Homologene: 41023
Grk3
Name: G protein-coupled receptor kinase 3
Synonyms: beta ARK2, Bark-2, Adrbk-2, 4833444A01Rik, Adrbk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320129
HGNC: HGNC:290
Homologene: 21072
Tesc
Name: tescalcin
Synonyms: TE-1, 2410011K10Rik, 1010001A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 57816
Homologene: 75158
Vmn1r56
Name: vomeronasal 1 receptor 56
Synonyms: V3R3, V1rd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 81015
Homologene: 41799
Fsd2
Name: fibronectin type III and SPRY domain containing 2
Synonyms: Spryd1, 9830160G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244091
Homologene: 18252
Tmprss9
Name: transmembrane protease, serine 9
Synonyms: Serase-1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432478
VEGA: 10
Homologene: 115302
Ncln
Name: nicalin
Synonyms: 3100002P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103425
Homologene: 10604
Mfsd2b
Name: MFSD2 lysolipid transporter B, sphingolipid
Synonyms: major facilitator superfamily domain containing 2B, Gm1964
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432628
Homologene: 47753
Ercc6l2
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms: 1700019D06Rik, 9330134C04Rik, 0610007P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76251
Homologene: 32564
Lacc1
Name: laccase domain containing 1
Synonyms: 9030625A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 210808
Homologene: 17712
Nr1i2
Name: nuclear receptor subfamily 1, group I, member 2
Synonyms: PXR.2, PXR.1, Pregnane X receptor, mPXR, PXR, SXR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 18171
HGNC: HGNC:7968
Homologene: 40757
C2
Name: complement C2
Synonyms: classical-complement pathway C3/C5 convertase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12263
HGNC: HGNC:1248
Homologene: 45
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 211924
HGNC: HGNC:3048
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 38,871,729 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • A to T, chromosome 1 at 178,915,389 bp
  • A to C, chromosome 1 at 188,996,398 bp
  • G to A, chromosome 2 at 18,683,284 bp
  • A to G, chromosome 2 at 55,098,603 bp
  • T to A, chromosome 2 at 90,746,802 bp
  • C to A, chromosome 2 at 119,179,934 bp
  • A to T, chromosome 3 at 64,492,588 bp
  • G to A, chromosome 3 at 87,913,109 bp
  • G to A, chromosome 3 at 90,172,113 bp
  • C to A, chromosome 4 at 11,548,783 bp
  • A to G, chromosome 4 at 58,118,232 bp
  • A to C, chromosome 4 at 117,905,569 bp
  • T to G, chromosome 4 at 126,516,932 bp
  • A to G, chromosome 4 at 128,585,837 bp
  • A to T, chromosome 4 at 133,250,946 bp
  • T to A, chromosome 4 at 136,327,282 bp
  • A to G, chromosome 5 at 8,088,077 bp
  • T to C, chromosome 5 at 23,527,930 bp
  • A to G, chromosome 5 at 30,913,920 bp
  • G to A, chromosome 5 at 65,143,350 bp
  • A to G, chromosome 5 at 111,277,457 bp
  • A to T, chromosome 5 at 112,915,053 bp
  • A to T, chromosome 5 at 118,056,570 bp
  • C to T, chromosome 5 at 135,180,607 bp
  • A to T, chromosome 5 at 149,188,349 bp
  • A to G, chromosome 6 at 12,418,335 bp
  • G to T, chromosome 6 at 118,603,882 bp
  • T to C, chromosome 6 at 119,348,842 bp
  • A to G, chromosome 6 at 140,007,697 bp
  • C to T, chromosome 7 at 5,196,373 bp
  • G to A, chromosome 7 at 6,962,335 bp
  • T to C, chromosome 7 at 81,473,080 bp
  • T to A, chromosome 7 at 81,559,935 bp
  • G to T, chromosome 7 at 106,741,765 bp
  • C to A, chromosome 7 at 107,744,177 bp
  • T to A, chromosome 8 at 10,569,790 bp
  • G to A, chromosome 8 at 13,477,040 bp
  • A to C, chromosome 8 at 71,461,862 bp
  • A to T, chromosome 8 at 84,721,686 bp
  • A to T, chromosome 8 at 87,780,340 bp
  • C to T, chromosome 8 at 109,907,513 bp
  • A to G, chromosome 8 at 121,753,371 bp
  • A to T, chromosome 9 at 38,048,110 bp
  • C to T, chromosome 9 at 44,507,112 bp
  • C to T, chromosome 9 at 53,635,050 bp
  • C to T, chromosome 9 at 75,160,574 bp
  • C to A, chromosome 9 at 118,636,586 bp
  • A to G, chromosome 10 at 27,187,845 bp
  • G to A, chromosome 10 at 43,999,063 bp
  • T to C, chromosome 10 at 70,925,370 bp
  • T to C, chromosome 10 at 79,815,175 bp
  • A to G, chromosome 10 at 80,894,378 bp
  • G to A, chromosome 10 at 81,487,597 bp
  • C to A, chromosome 11 at 21,857,444 bp
  • C to T, chromosome 11 at 34,082,418 bp
  • G to A, chromosome 11 at 84,894,603 bp
  • T to C, chromosome 11 at 94,214,597 bp
  • T to G, chromosome 11 at 110,188,641 bp
  • A to G, chromosome 12 at 4,866,234 bp
  • A to G, chromosome 13 at 30,540,942 bp
  • A to C, chromosome 13 at 63,872,506 bp
  • C to T, chromosome 14 at 14,861,560 bp
  • G to T, chromosome 14 at 55,108,326 bp
  • T to C, chromosome 14 at 70,567,135 bp
  • A to T, chromosome 14 at 77,030,799 bp
  • T to C, chromosome 16 at 38,253,006 bp
  • A to C, chromosome 16 at 44,490,241 bp
  • T to A, chromosome 17 at 34,873,528 bp
  • T to A, chromosome 18 at 20,270,481 bp
  • A to T, chromosome 19 at 10,664,612 bp
  • A to T, chromosome 19 at 13,749,255 bp
  • G to T, chromosome 19 at 22,987,916 bp
  • A to G, chromosome 19 at 29,718,254 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0142 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038427-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.