MMRRC:038494-MU

GGCTGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 1 at 52,232,694 bp
A to G, chromosome 1 at 53,926,698 bp
A to T, chromosome 1 at 66,380,722 bp
A to G, chromosome 1 at 133,355,611 bp
G to T, chromosome 1 at 180,155,782 bp
T to C, chromosome 2 at 52,090,286 bp
C to A, chromosome 2 at 55,594,959 bp
A to G, chromosome 2 at 85,591,301 bp
A to T, chromosome 2 at 88,025,468 bp
C to A, chromosome 2 at 103,727,917 bp
G to C, chromosome 2 at 104,167,950 bp
C to A, chromosome 2 at 125,257,091 bp
G to A, chromosome 2 at 164,826,126 bp
A to G, chromosome 2 at 172,551,503 bp
A to T, chromosome 3 at 92,925,731 bp
T to C, chromosome 3 at 152,219,713 bp
A to T, chromosome 4 at 32,644,079 bp
A to T, chromosome 4 at 141,477,557 bp
A to T, chromosome 4 at 143,810,768 bp
A to T, chromosome 4 at 144,622,995 bp
C to G, chromosome 4 at 148,055,428 bp
A to G, chromosome 4 at 150,908,349 bp
T to A, chromosome 5 at 64,105,808 bp
T to A, chromosome 5 at 65,348,837 bp
A to G, chromosome 5 at 96,737,009 bp
T to C, chromosome 5 at 110,009,063 bp
A to G, chromosome 5 at 113,752,399 bp
T to C, chromosome 5 at 120,681,291 bp
C to A, chromosome 6 at 48,465,555 bp
A to G, chromosome 6 at 58,868,628 bp
A to T, chromosome 6 at 84,574,572 bp
C to T, chromosome 7 at 13,008,327 bp
A to T, chromosome 7 at 27,165,247 bp
T to A, chromosome 7 at 29,574,602 bp
G to A, chromosome 7 at 33,743,853 bp
G to A, chromosome 7 at 45,726,910 bp
T to A, chromosome 7 at 99,471,751 bp
A to G, chromosome 7 at 131,238,176 bp
G to A, chromosome 7 at 140,323,155 bp
T to C, chromosome 8 at 3,849,125 bp
T to A, chromosome 8 at 11,267,588 bp
A to G, chromosome 8 at 104,322,434 bp
A to C, chromosome 9 at 58,860,162 bp
A to T, chromosome 9 at 76,197,101 bp
A to G, chromosome 9 at 76,228,188 bp
G to A, chromosome 9 at 82,871,288 bp
T to A, chromosome 9 at 123,118,960 bp
C to T, chromosome 10 at 78,917,605 bp
A to T, chromosome 10 at 107,705,548 bp
T to A, chromosome 10 at 108,273,381 bp
G to A, chromosome 10 at 116,252,963 bp
T to C, chromosome 10 at 122,449,709 bp
A to T, chromosome 10 at 129,647,176 bp
C to A, chromosome 11 at 44,643,413 bp
T to A, chromosome 11 at 51,048,941 bp
G to A, chromosome 11 at 59,067,272 bp
T to A, chromosome 11 at 100,246,525 bp
T to A, chromosome 11 at 116,126,644 bp
G to A, chromosome 12 at 4,700,333 bp
C to A, chromosome 12 at 51,769,107 bp
T to C, chromosome 12 at 51,769,108 bp
G to A, chromosome 13 at 9,637,150 bp
A to C, chromosome 14 at 21,037,102 bp
T to C, chromosome 14 at 55,625,942 bp
T to A, chromosome 14 at 103,314,325 bp
C to A, chromosome 15 at 44,597,011 bp
T to C, chromosome 15 at 89,196,229 bp
C to A, chromosome 15 at 101,541,713 bp
A to T, chromosome 16 at 5,222,167 bp
T to A, chromosome 16 at 10,644,828 bp
T to C, chromosome 16 at 31,684,193 bp
T to C, chromosome 16 at 32,360,046 bp
A to G, chromosome 17 at 10,209,646 bp
A to G, chromosome 17 at 19,677,850 bp
A to T, chromosome 17 at 20,208,676 bp
A to T, chromosome 17 at 21,745,841 bp
C to T, chromosome 17 at 30,274,942 bp
A to G, chromosome 17 at 30,769,707 bp
A to G, chromosome 17 at 46,814,052 bp
T to C, chromosome 17 at 57,296,090 bp
G to A, chromosome 17 at 63,385,067 bp
T to C, chromosome 17 at 71,697,998 bp
T to A, chromosome 17 at 79,077,652 bp
A to G, chromosome 18 at 31,944,520 bp
C to A, chromosome 18 at 77,780,195 bp
A to G, chromosome 19 at 10,477,085 bp
T to A, chromosome 19 at 20,709,502 bp
T to A, chromosome 19 at 22,897,521 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R0268 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
038494-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All