Strain Name:
C57BL/6J-MtgxR0268Btlr/Mmmh
Stock Number:
038494-MU
Citation ID:
RRID:MMRRC_038494-MU
Other Names:
R0268 (G1), C57BL/6J-MtgxR0268Btlr
Major Collection:

Gene Information

Qk
Name: quaking
Synonyms: QkI, l17Wis1, 1110003F05Rik, l(17)-1Wis
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 19317
VEGA: 17
Homologene: 11059
Park7
Name: Parkinson disease (autosomal recessive, early onset) 7
Synonyms: DJ-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 57320
Homologene: 38295
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Dlg1
Name: discs large MAGUK scaffold protein 1
Synonyms: Dlgh1, B130052P05Rik, SAP97
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13383
HGNC: HGNC:2900
Homologene: 20869
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56381
Homologene: 124461
Bicral
Name: BRD4 interacting chromatin remodeling complex associated protein like
Synonyms: Gltscr1l, BC032203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 210982
VEGA: 17
Homologene: 19366
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 208440
Homologene: 40996
Egln2
Name: egl-9 family hypoxia-inducible factor 2
Synonyms: SM-20, Hif-p4h-1, Ier4, 0610011A13Rik, Phd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 112406
Homologene: 14204
Hcn4
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 330953
VEGA: 9
Homologene: 3997
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 105689
Homologene: 9005
Fbxl17
Name: F-box and leucine-rich repeat protein 17
Synonyms: Fbx13, C130023C01Rik, 6330576B01Rik, Fbxo13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 50758
Homologene: 79859
Btbd9
Name: BTB (POZ) domain containing 9
Synonyms: 1700023F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224671
VEGA: 17
Homologene: 14995
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 53890
Homologene: 40977
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 5730577I22Rik, Mypt1, D10Ertd625e, 1200015F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 207304
VEGA: 12
Homologene: 9115
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, 4632404O06Rik, 2810004D21Rik, Ndrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 83946
Homologene: 41209
Rif1
Name: replication timing regulatory factor 1
Synonyms: D2Ertd145e, 5730435J01Rik, 6530403D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 51869
Homologene: 41231
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: 4932416N17Rik, curt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 74374
Homologene: 71019
Gls
Name: glutaminase
Synonyms: B230365M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14660
HGNC: HGNC:4331
Homologene: 22726
Nat10
Name: N-acetyltransferase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 98956
Homologene: 6785
Tfap2c
Name: transcription factor AP-2, gamma
Synonyms: Tcfap2c, AP2gamma, Ap-2.2, Stra2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 21420
Homologene: 2423
Fubp1
Name: far upstream element (FUSE) binding protein 1
Synonyms: 9530027K12Rik, Fubp4, Fubp, FBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 51886
HGNC: HGNC:4004
Homologene: 48253
Atp5a1
Name: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1
Synonyms: Mom2, Atpm, D18Ertd206e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 11946
HGNC: HGNC:823
Homologene: 2985
Zbtb45
Name: zinc finger and BTB domain containing 45
Synonyms: LOC232879, Zfp499
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232879
Homologene: 13118
Kcnj3
Name: potassium inwardly-rectifying channel, subfamily J, member 3
Synonyms: Kir3.1, Kcnf3, GIRK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16519
HGNC: HGNC:6264
Homologene: 1687
Avpr1a
Name: arginine vasopressin receptor 1A
Synonyms: V1aR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 54140
HGNC: HGNC:895
Homologene: 568
AU021092
Name: expressed sequence AU021092
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 239691
Homologene: 17587
Gfral
Name: GDNF family receptor alpha like
Synonyms: GRAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 404194
Homologene: 45748
Map2
Name: microtubule-associated protein 2
Synonyms: G1-397-34, repro4, MAP-2, Mtap2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, Dnahc8, P1-Loop
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Sh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Casp8ap2
Name: caspase 8 associated protein 2
Synonyms: D4Ertd659e, FLASH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 26885
HGNC: HGNC:1510
Homologene: 8066
Exosc7
Name: exosome component 7
Synonyms: 2610002K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 66446
Homologene: 8994
Zswim1
Name: zinc finger SWIM-type containing 1
Synonyms: 2410003H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 71971
Homologene: 12429
Ap3m1
Name: adaptor-related protein complex 3, mu 1 subunit
Synonyms: 1200013D09Rik, C78982
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 55946
HGNC: HGNC:569
Homologene: 22693
Ubxn7
Name: UBX domain protein 7
Synonyms: Ubxd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224111
VEGA: 16
Homologene: 45585
Ebf1
Name: early B cell factor 1
Synonyms: O/E-1, Olf-1, Olf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 13591
HGNC: HGNC:3126
Homologene: 7297
Vav1
Name: vav 1 oncogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 22324
Homologene: 3961
Klb
Name: klotho beta
Synonyms: betaKlotho
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 83379
Homologene: 12820
4930432E11Rik
Name: RIKEN cDNA 4930432E11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 243900
Dennd6b
Name: DENN/MADD domain containing 6B
Synonyms: 1700027J05Rik, Fam116b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 69440
VEGA: 15
Homologene: 57065
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: A930014J19Rik, DMPK-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, LTRPC3, melastatin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226025
VEGA: 19
Homologene: 62287
Ptprq
Name: protein tyrosine phosphatase, receptor type, Q
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: fibrocystin L, PKHDL1, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 192190
Homologene: 16332
Cdcp3
Name: CUB domain containing protein 3
Synonyms: 5430419D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71395
Homologene: 138430
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241589
Homologene: 115928
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 380698
Homologene: 70869
Aadacl4
Name: arylacetamide deacetylase like 4
Synonyms: Gm13177
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 435815
Homologene: 82530
Hcrtr2
Name: hypocretin (orexin) receptor 2
Synonyms: OX2r, mOXR2, mOX2aR, mOX2bR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 387285
HGNC: HGNC:4849
Homologene: 1168
Vmn2r102
Name: vomeronasal 2, receptor 102
Synonyms: EG224572
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224572
Homologene: 115024
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231470
Homologene: 23516
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Del(8)44H, Raw, Del(8)Bru44H, Col4a-1, alpha1(IV) collagen, Svc, Bru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Hecw2
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms: D030049F17Rik, A730039N16Rik, Nedl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 329152
Homologene: 66192
Olfr799
Name: olfactory receptor 799
Synonyms: GA_x6K02T2PULF-11325750-11326685, MOR114-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258929
Homologene: 37000
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 243369
Homologene: 45453
Olfr998
Name: olfactory receptor 998
Synonyms: MOR175-5, GA_x6K02T2Q125-47069356-47070300
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258428
Homologene: 74236
Dtx1
Name: deltex 1, E3 ubiquitin ligase
Synonyms: Fxit1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 14357
HGNC: HGNC:3060
Homologene: 74522
Vmn2r105
Name: vomeronasal 2, receptor 105
Synonyms: EG627743
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627743
Homologene: 129680
Trim65
Name: tripartite motif-containing 65
Synonyms: 4732463G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 338364
Homologene: 27844
Cd209e
Name: CD209e antigen
Synonyms: SIGNR4, mSIGNR4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 170780
HGNC: HGNC:1641
Homologene: 128353
Cyp26b1
Name: cytochrome P450, family 26, subfamily b, polypeptide 1
Synonyms: CP26, P450RAI-2, retinoic acid B1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232174
Homologene: 23179
Aldh1a7
Name: aldehyde dehydrogenase family 1, subfamily A7
Synonyms: Aldh-pb, Ahd2-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 26358
HGNC: HGNC:402
Homologene: 137245
Zfp932
Name: zinc finger protein 932
Synonyms: 2310001H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 69504
Homologene: 137770
Togaram2
Name: TOG array regulator of axonemal microtubules 2
Synonyms: Fam179a, 4632412N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 320159
Homologene: 65315
Pgm2
Name: phosphoglucomutase 2
Synonyms: 3230402E02Rik, Pgm1, Pgm-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 66681
HGNC: HGNC:8906
Homologene: 6693
Ppp1r32
Name: protein phosphatase 1, regulatory subunit 32
Synonyms: 4930579J09Rik, IIIG9S, IIIG9L, IIIG9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 67752
VEGA: 19
Homologene: 15863
Ren1
Name: renin 1 structural
Synonyms: Ren-1, Ren, Ren1d, Rn-1, Rnr, Ren1c, Ren-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Olfr1161
Name: olfactory receptor 1161
Synonyms: GA_x6K02T2Q125-49516664-49517629, MOR174-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258845
Homologene: 138318
Dut
Name: deoxyuridine triphosphatase
Synonyms: Dutp, 5031412I06Rik, dUTPase, D2Bwg0749e, 5133400F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 110074
HGNC: HGNC:3078
Homologene: 31475
Lce3a
Name: late cornified envelope 3A
Synonyms: EG545548
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 545548
Homologene: 134278
Gm13084
Name: predicted gene 13084
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 381569
Homologene: 77858
Scgb1b24
Name: secretoglobin, family 1B, member 24
Synonyms: Gm12769, Abpa24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100043860
Homologene: 114479
Fam83e
Name: family with sequence similarity 83, member E
Synonyms: 4930403C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 73813
Homologene: 9791
Klhl35
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 72184
Homologene: 27849
Olfr525
Name: olfactory receptor 525
Synonyms: GA_x6K02T2PBJ9-42472898-42473827, MOR251-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258958
Homologene: 138321
Cmtm2b
Name: CKLF-like MARVEL transmembrane domain containing 2B
Synonyms: 1700013O04Rik, Cklfsf2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 75502
Homologene: 88915
Olfr1354
Name: olfactory receptor 1354
Synonyms: MOR139-5, GA_x6K02T03FR9-4826-3919, EG257869, MOR139-7, Olfr233-ps1, GA_x6K02T2QGN0-2895081-2894349, MOR185-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 259163
Homologene: 136441
Ptprr
Name: protein tyrosine phosphatase, receptor type, R
Synonyms: PTPBR7, PTP-SL, RPTPRR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 19279
HGNC: HGNC:9680
Homologene: 2135
Olfr1375
Name: olfactory receptor 1375
Synonyms: GA_x6K02T2QP88-4389999-4389056, Olfr1375-ps1, MOR126-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258509
Krt16
Name: keratin 16
Synonyms: K16, Krt1-16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16666
HGNC: HGNC:6423
Homologene: 21145
Ipo4
Name: importin 4
Synonyms: 8430408O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 75751
Homologene: 5835
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Zfp229
Name: zinc finger protein 229
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 381067
Homologene: 136287
Qpct
Name: glutaminyl-peptide cyclotransferase (glutaminyl cyclase)
Synonyms: 5730422A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 70536
VEGA: 17
HGNC: HGNC:9753
Homologene: 8238
Lims2
Name: LIM and senescent cell antigen like domains 2
Synonyms: PINCH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225341
VEGA: 18
Homologene: 41214
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • GGCTGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 1 at 52,232,694 bp
  • A to G, chromosome 1 at 53,926,698 bp
  • A to T, chromosome 1 at 66,380,722 bp
  • A to G, chromosome 1 at 133,355,611 bp
  • G to T, chromosome 1 at 180,155,782 bp
  • T to C, chromosome 2 at 52,090,286 bp
  • C to A, chromosome 2 at 55,594,959 bp
  • A to G, chromosome 2 at 85,591,301 bp
  • A to T, chromosome 2 at 88,025,468 bp
  • C to A, chromosome 2 at 103,727,917 bp
  • G to C, chromosome 2 at 104,167,950 bp
  • C to A, chromosome 2 at 125,257,091 bp
  • G to A, chromosome 2 at 164,826,126 bp
  • A to G, chromosome 2 at 172,551,503 bp
  • A to T, chromosome 3 at 92,925,731 bp
  • T to C, chromosome 3 at 152,219,713 bp
  • A to T, chromosome 4 at 32,644,079 bp
  • A to T, chromosome 4 at 141,477,557 bp
  • A to T, chromosome 4 at 143,810,768 bp
  • A to T, chromosome 4 at 144,622,995 bp
  • C to G, chromosome 4 at 148,055,428 bp
  • A to G, chromosome 4 at 150,908,349 bp
  • T to A, chromosome 5 at 64,105,808 bp
  • T to A, chromosome 5 at 65,348,837 bp
  • A to G, chromosome 5 at 96,737,009 bp
  • T to C, chromosome 5 at 110,009,063 bp
  • A to G, chromosome 5 at 113,752,399 bp
  • T to C, chromosome 5 at 120,681,291 bp
  • C to A, chromosome 6 at 48,465,555 bp
  • A to G, chromosome 6 at 58,868,628 bp
  • A to T, chromosome 6 at 84,574,572 bp
  • C to T, chromosome 7 at 13,008,327 bp
  • A to T, chromosome 7 at 27,165,247 bp
  • T to A, chromosome 7 at 29,574,602 bp
  • G to A, chromosome 7 at 33,743,853 bp
  • G to A, chromosome 7 at 45,726,910 bp
  • T to A, chromosome 7 at 99,471,751 bp
  • A to G, chromosome 7 at 131,238,176 bp
  • G to A, chromosome 7 at 140,323,155 bp
  • T to C, chromosome 8 at 3,849,125 bp
  • T to A, chromosome 8 at 11,267,588 bp
  • A to G, chromosome 8 at 104,322,434 bp
  • A to C, chromosome 9 at 58,860,162 bp
  • A to T, chromosome 9 at 76,197,101 bp
  • A to G, chromosome 9 at 76,228,188 bp
  • G to A, chromosome 9 at 82,871,288 bp
  • T to A, chromosome 9 at 123,118,960 bp
  • C to T, chromosome 10 at 78,917,605 bp
  • A to T, chromosome 10 at 107,705,548 bp
  • T to A, chromosome 10 at 108,273,381 bp
  • G to A, chromosome 10 at 116,252,963 bp
  • T to C, chromosome 10 at 122,449,709 bp
  • A to T, chromosome 10 at 129,647,176 bp
  • C to A, chromosome 11 at 44,643,413 bp
  • T to A, chromosome 11 at 51,048,941 bp
  • G to A, chromosome 11 at 59,067,272 bp
  • T to A, chromosome 11 at 100,246,525 bp
  • T to A, chromosome 11 at 116,126,644 bp
  • G to A, chromosome 12 at 4,700,333 bp
  • C to A, chromosome 12 at 51,769,107 bp
  • T to C, chromosome 12 at 51,769,108 bp
  • G to A, chromosome 13 at 9,637,150 bp
  • A to C, chromosome 14 at 21,037,102 bp
  • T to C, chromosome 14 at 55,625,942 bp
  • T to A, chromosome 14 at 103,314,325 bp
  • C to A, chromosome 15 at 44,597,011 bp
  • T to C, chromosome 15 at 89,196,229 bp
  • C to A, chromosome 15 at 101,541,713 bp
  • A to T, chromosome 16 at 5,222,167 bp
  • T to A, chromosome 16 at 10,644,828 bp
  • T to C, chromosome 16 at 31,684,193 bp
  • T to C, chromosome 16 at 32,360,046 bp
  • A to G, chromosome 17 at 10,209,646 bp
  • A to G, chromosome 17 at 19,677,850 bp
  • A to T, chromosome 17 at 20,208,676 bp
  • A to T, chromosome 17 at 21,745,841 bp
  • C to T, chromosome 17 at 30,274,942 bp
  • A to G, chromosome 17 at 30,769,707 bp
  • A to G, chromosome 17 at 46,814,052 bp
  • T to C, chromosome 17 at 57,296,090 bp
  • G to A, chromosome 17 at 63,385,067 bp
  • T to C, chromosome 17 at 71,697,998 bp
  • T to A, chromosome 17 at 79,077,652 bp
  • A to G, chromosome 18 at 31,944,520 bp
  • C to A, chromosome 18 at 77,780,195 bp
  • A to G, chromosome 19 at 10,477,085 bp
  • T to A, chromosome 19 at 20,709,502 bp
  • T to A, chromosome 19 at 22,897,521 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0268 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
038494-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.