Strain Name:
C57BL/6J-MtgxR0268Btlr/Mmmh
Stock Number:
038494-MU
Citation ID:
RRID:MMRRC_038494-MU
Other Names:
R0268 (G1), C57BL/6J-MtgxR0268Btlr
Major Collection:

Gene Information

Gene Symbol: Qk [MGI:97837] (Mus musculus (mouse))
Name: quaking
Synonyms: 1110003F05Rik, l17Wis1, QkI, l(17)-1Wis
Chromosome: 17
Alteration at locus: Chemically Induced
Gene Symbol: Park7 [MGI:2135637] (Mus musculus (mouse))
Name: Parkinson disease (autosomal recessive, early onset) 7
Synonyms: DJ-1
Chromosome: 4
Alteration at locus: Chemically Induced
Gene Symbol: Herc3 [MGI:1921248] (Mus musculus (mouse))
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Chromosome: 6
Alteration at locus: Chemically Induced
Gene Symbol: Mthfr [MGI:106639] (Mus musculus (mouse))
Name: methylenetetrahydrofolate reductase
Chromosome: 4
Alteration at locus: Chemically Induced
Gene Symbol: Dlg1 [MGI:107231] (Mus musculus (mouse))
Name: discs large MAGUK scaffold protein 1
Synonyms: B130052P05Rik, SAP97, Dlgh1
Chromosome: 16
Alteration at locus: Chemically Induced
Gene Symbol: Spen [MGI:1891706] (Mus musculus (mouse))
Name: spen family transcription repressor
Synonyms: Mint
Chromosome: 4
Alteration at locus: Chemically Induced
Gene Symbol: Bicral [MGI:2673855] (Mus musculus (mouse))
Name: BRD4 interacting chromatin remodeling complex associated protein like
Synonyms: BC032203, Gltscr1l
Chromosome: 17
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • GGCTGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 1 at 52,232,694 bp
  • A to G, chromosome 1 at 53,926,698 bp
  • A to T, chromosome 1 at 66,380,722 bp
  • A to G, chromosome 1 at 133,355,611 bp
  • G to T, chromosome 1 at 180,155,782 bp
  • T to C, chromosome 2 at 52,090,286 bp
  • C to A, chromosome 2 at 55,594,959 bp
  • A to G, chromosome 2 at 85,591,301 bp
  • A to T, chromosome 2 at 88,025,468 bp
  • C to A, chromosome 2 at 103,727,917 bp
  • G to C, chromosome 2 at 104,167,950 bp
  • C to A, chromosome 2 at 125,257,091 bp
  • G to A, chromosome 2 at 164,826,126 bp
  • A to G, chromosome 2 at 172,551,503 bp
  • A to T, chromosome 3 at 92,925,731 bp
  • T to C, chromosome 3 at 152,219,713 bp
  • A to T, chromosome 4 at 32,644,079 bp
  • A to T, chromosome 4 at 141,477,557 bp
  • A to T, chromosome 4 at 143,810,768 bp
  • A to T, chromosome 4 at 144,622,995 bp
  • C to G, chromosome 4 at 148,055,428 bp
  • A to G, chromosome 4 at 150,908,349 bp
  • T to A, chromosome 5 at 64,105,808 bp
  • T to A, chromosome 5 at 65,348,837 bp
  • A to G, chromosome 5 at 96,737,009 bp
  • T to C, chromosome 5 at 110,009,063 bp
  • A to G, chromosome 5 at 113,752,399 bp
  • T to C, chromosome 5 at 120,681,291 bp
  • C to A, chromosome 6 at 48,465,555 bp
  • A to G, chromosome 6 at 58,868,628 bp
  • A to T, chromosome 6 at 84,574,572 bp
  • C to T, chromosome 7 at 13,008,327 bp
  • A to T, chromosome 7 at 27,165,247 bp
  • T to A, chromosome 7 at 29,574,602 bp
  • G to A, chromosome 7 at 33,743,853 bp
  • G to A, chromosome 7 at 45,726,910 bp
  • T to A, chromosome 7 at 99,471,751 bp
  • A to G, chromosome 7 at 131,238,176 bp
  • G to A, chromosome 7 at 140,323,155 bp
  • T to C, chromosome 8 at 3,849,125 bp
  • T to A, chromosome 8 at 11,267,588 bp
  • A to G, chromosome 8 at 104,322,434 bp
  • A to C, chromosome 9 at 58,860,162 bp
  • A to T, chromosome 9 at 76,197,101 bp
  • A to G, chromosome 9 at 76,228,188 bp
  • G to A, chromosome 9 at 82,871,288 bp
  • T to A, chromosome 9 at 123,118,960 bp
  • C to T, chromosome 10 at 78,917,605 bp
  • A to T, chromosome 10 at 107,705,548 bp
  • T to A, chromosome 10 at 108,273,381 bp
  • G to A, chromosome 10 at 116,252,963 bp
  • T to C, chromosome 10 at 122,449,709 bp
  • A to T, chromosome 10 at 129,647,176 bp
  • C to A, chromosome 11 at 44,643,413 bp
  • T to A, chromosome 11 at 51,048,941 bp
  • G to A, chromosome 11 at 59,067,272 bp
  • T to A, chromosome 11 at 100,246,525 bp
  • T to A, chromosome 11 at 116,126,644 bp
  • G to A, chromosome 12 at 4,700,333 bp
  • C to A, chromosome 12 at 51,769,107 bp
  • T to C, chromosome 12 at 51,769,108 bp
  • G to A, chromosome 13 at 9,637,150 bp
  • A to C, chromosome 14 at 21,037,102 bp
  • T to C, chromosome 14 at 55,625,942 bp
  • T to A, chromosome 14 at 103,314,325 bp
  • C to A, chromosome 15 at 44,597,011 bp
  • T to C, chromosome 15 at 89,196,229 bp
  • C to A, chromosome 15 at 101,541,713 bp
  • A to T, chromosome 16 at 5,222,167 bp
  • T to A, chromosome 16 at 10,644,828 bp
  • T to C, chromosome 16 at 31,684,193 bp
  • T to C, chromosome 16 at 32,360,046 bp
  • A to G, chromosome 17 at 10,209,646 bp
  • A to G, chromosome 17 at 19,677,850 bp
  • A to T, chromosome 17 at 20,208,676 bp
  • A to T, chromosome 17 at 21,745,841 bp
  • C to T, chromosome 17 at 30,274,942 bp
  • A to G, chromosome 17 at 30,769,707 bp
  • A to G, chromosome 17 at 46,814,052 bp
  • T to C, chromosome 17 at 57,296,090 bp
  • G to A, chromosome 17 at 63,385,067 bp
  • T to C, chromosome 17 at 71,697,998 bp
  • T to A, chromosome 17 at 79,077,652 bp
  • A to G, chromosome 18 at 31,944,520 bp
  • C to A, chromosome 18 at 77,780,195 bp
  • A to G, chromosome 19 at 10,477,085 bp
  • T to A, chromosome 19 at 20,709,502 bp
  • T to A, chromosome 19 at 22,897,521 bp
Genotype Determination
ES Cell Line
N/A
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
MeSH Terms
    Strain Development
    C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
    Suggested Control Mice
    Wild-type littermates or C57BL/6J mice
    Donor
    Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
    Primary Reference
    MUTAGENETIX record for R0268 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
    Coat Color
    Black
    MMRRC Breeding System
    Random intra-strain mating
    Breeding Scheme(s)
    When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
    Overall Breeding Performance
    Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
    Average litter size
    Undetermined
    Recommended wean age
    3 weeks

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
    038494-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

    Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

    1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.